COMPOUND UNDERSTANDING OLIGONUCLEOTIDE, COMPOSITION, AND ITS USES TO PREVENT TREAT, IMPROVE, OR SLOW

专利摘要:
COMPOUND UNDERSTANDING OLIGONUCLEOTIDE, COMPOSITION, AND ITS USES TO PREVENT TREATING, IMPROVING OR DELAYING PROGRESSION OF TRANSYSTERRETIN AMYLOIDOSIS OR TO REDUCE THE EXPRESSION OF MRNA OR TRANSTRETREIN PROTEIN ". The present invention relates to methods, compounds and compositions for reducing the expression of transthyretin and protein mRNA in an animal. These methods, compounds and compositions are useful for treating, preventing, delaying or ameliorating transthyretin amyloidosis, or a symptom thereof.
公开号:BR112012027547A2
申请号:R112012027547-0
申请日:2011-04-29
公开日:2020-10-13
发明作者:Brett P. Monia；Susan M. Freier；Andrew M. Siwkowski
申请人:Isis Pharmaceuticals, Inc；
IPC主号:

专利说明:

Invention Patent Descriptive Report for "COMPOUND UNDERSTANDING OLIGONUCLEOTIDE, COMPOSITION, AND ITS USES TO PREVENT TREAT, IMPROVE OR DELAY PROTECTION
GROSSION OF TRANSYSTYRETIN AMYLOIDOSIS OR TO REDUCE THE EXPRESSION OF TRANSTIRRETIN MRNA OR PROTEIN ".
SEQUENCE LISTING This application is being filed, together with a Sequence List in electronic format. The String Listing is provided as a file entitled BIOLO123WOSEOQ.txt created on April 28, 2011, which is 55 Kb in size. The information in the electronic format of the sequence listing is incorporated in this document for reference in its entirety.
FIELD OF THE INVENTION Methods, compounds, and compositions for reducing the expression of transthyretin and protein mRNA in an animal are provided herein. Such methods, compounds, and compositions are useful, for example, to treat, prevent, or improve transthyretin amyloidosis.
BACKGROUND OF THE INVENTION Transthyretin (TTR), (also known as pre-albumin, hyperthyroxinemia, dysprealbuminemic, thyroxine; senile systemic amyloidosis, amyloid polyneuropathy, amyloidosis |, PALB; dystanstirretinimica, HST2651; TBPA; / plasma and cerebrospinal fluid responsible for the transport of thyroxine and retinol (Sakaki et. al, Mol do Biol Med. 1989, 6: 161-8). Structurally, aTTR is a homotetramer; Point mutations and protein unfolding lead to the deposition of amyloid fibrils and is associated with disorders, such as senile systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP), and familial amyloid heart disease (FAC). TTR is synthesized mainly by the liver and the cerebral plexus of the brain and, to a lesser extent, by the retina in humans (Palha, Clin Chem Lab Med, 2002, 40, 1292-1300). The transthyretin that is synthesized in the liver is secreted in the blood, while the transthyretin that originates in the
1a / 232 choroid plexus is intended for CSF.
In the choroid plexus, transthyretin synthesis represents approximately 20% of the total local protein synthesis and as much as 25% of the total CSF protein (Dickson et. Al., Biol Chem de
+ J, 1986, 261, 3475-3478).
With the availability of genetic and immunohistochemical diagnostic tests, patients with TTR amyloidosis have been found in many nations around the world. Recent studies indicate that TTR amyloidosis is not a rare endemic disease as previously thought and that it can affect as much as 25% of the elderly population (Tanskanen et al, Ann Med. 2008; 40 (3): 232-9).
At the biochemical level, TTR was identified as the main protein component in amyloid deposits of FAP patients (Costa et al, proc.Proc. Natl. Acad. Sci. USA 1978, 75: 4499 - 4503) and later, a replacement of methionine by valine at position 30 of the protein was considered the most common molecular defect that causes the disease (Saraiva et. al, J. Clin. Invest. 1984, 74: 104—119). In FAP, scattered systemic extracellular deposition of TTR aggregates and amyloid fibrils occurs throughout the + 15 connective tissue, particularly in the peripheral nervous system (Sousa and Saraiva, Prog. Neurobiol. 2003, 71: 385400). After the deposition of TTR, fr axonic degeneration occurs, starting in the myelinated and demyelinated fibers of smaller diameter, and finally leading to neuronal loss in the ganglion sites.
The compounds and treatment methods described in this document provide significant advantages over the treatment options currently available for disorders related to TTR. Amyloidosis TTR usually leads to death within ten years, and until recently, it was considered incurable. Liver transplantation is an effective means of replacing the disease-associated allele with a wild-type (WT) allele in family cases because the liver is normally the source of amyloidogenic TTR. Although liver transplantation is effective as a form of gene therapy, it is not without problems. Transplantation is complicated by the need for invasive surgery for the recipient and donor, long-term post-transplant immuno-suppression therapy, scarcity of donors, high cost, and a large number of TTR amyloidosis patients who are not good candidates due to disease progression. Unfortunately, cardiac amyloidosis progresses in some family patients even after a liver transplant because WT TTR often continues to deposit. The deposition in the central nervous system (CNS) of TTR is also not relieved by transplantation due to its synthesis by the choroid plexus. Transplantation is not a viable option for the most prevalent TTR disease, senile systemic amyloidosis (SSA), which affects approximately 25% of those over 80, due to the deposition of WT TTR. Antisense technology is emerging as an effective means of reducing the expression of specific gene products and, therefore, proves to be exceptionally useful in a number of therapeutic, diagnostic and research applications for modulating TTR expression (see US Patent Publications 2008 / 0039418 and 2007/0299027). The present invention provides compositions and methods for modulating transthyretin expression. The antisense compounds for the modulation of transthyretin expression are disclosed in the aforementioned published patent applications. However, there is still a need for more said compounds.
SUMMARY OF THE INVENTION Methods, compounds, and compositions for modulating the expression of mRNA and transthyretin protein are provided in this document. In certain embodiments, compounds useful for modulating the expression of mR-NA and TTR protein are antisense compounds. In certain modalities, antisense compounds are antisense oligonucleotides. In certain modalities, modulation can occur in an outdated cell. In certain embodiments, the cell or tissue is in an animal. In certain modalities, the animal is a human being. In certain embodiments, the levels of TTR MRNA are reduced. In certain embodiments, the levels of the TTR protein are reduced. This reduction can occur in a time-dependent or dose-dependent manner. Methods, compounds, and compositions are provided in this document to modulate transthyretin expression and treat, prevent, delay or improve transrretin amyloidosis and / or a symptom thereof. In certain embodiments are the methods, compounds, and compositions for modulating transthyretin expression and treating, preventing, delaying or ameliorating transthyretin amyloid disease or transthyretin amyloidosis or transthyretin-related amyloidosis (eg, hereditary TTR amyloidosis, —Leptomeningeal amyloidosis, transthyretin amyloid polyneuropathy, familial amyloid polyneuropathy, familial amyloid heart disease, or senile systemic amyloidosis). In certain modalities, an animal at risk of transthyretin amyloidosis is treated by administering to the anima! of a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: two; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide - consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13,: 14, 15 , 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal at risk for transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides, where the modified oligonucleotide is complementary to one transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a sequence of —nucleobases selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal at risk for transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, where the modified oligonucleotide is complementary to one transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of a sequence of - nucleobases selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal at risk for transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 linked nucleosides, where the modified oligonucleotide is complementary a transthyretin 7 nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucileotide consisting of 15 to 25 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal at risk for transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides, where the modified oligonucleotide is complementary to one transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124 In certain embodiments, an animal at risk for transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 to 30 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11,12,13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences - 15 reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124 In certain embodiments, an animal with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124. In certain embodiments , an animal with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, S 17,18,19or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124. In certain embodiments, an animal with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, s 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 linked nucleosides, where the modified oligonucleotide is complementary to a nucleic acid transthyretin as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides, where the modified oligonucleotide is complementary to a nucleic acid transthyretin as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122, or 124.
In certain embodiments, an animal at risk of transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound - 15 consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides — having a sequence of nucleobases comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, blood cell count 87.
In certain embodiments, an animal at risk of transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides, where the modified oligonucleotide it is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 nucleotides
linked osides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the sequences of nucleobases reported in SEQ ID NOs: 25, 80, 86, or Ss er.
In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleotides, where the oligonucleotide modified is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising - 15 at least 38,9,10,11,12, 13,14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any one. the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, or
87.
In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 linked nucleosides, where the modified oligonucleotide it is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or —SEQIDNO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, or
87.
In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucieotide consisting of 18 to 21 linked nucleosides, where the modified oligonucleotide it is complementary to —a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, or 87.
In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound - 15 consisting of a modified oligonucleotide consisting of 20 to 30 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 to 30 linked nucleosides — having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19 or 20 contiguous nucleobases of a nucleobase sequence selected from any of the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, or 87.
In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides, where the modified oligonucleotide it is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising
minus 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from the nucleobase sequence reported in SEQ ID NO: 80. In certain embodiments, an animal in risk of transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal an therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound - consisting of a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19 or 20 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80.
In certain embodiments, an animal at risk of amyloidosis - transthyretin or with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound r consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQIDNO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80.
In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 linked nucleosides, where the modified oligonucleotide it is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 15 to 25 nucleotides
linked osidae and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80 In certain embodiments, an animal at risk for transthyretin amyloidosis or transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides, where the oligonucleotide modified is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 18 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80. - 15 In certain embodiments, an animal at risk of transthyretin amyloidosis or transthyretin amyloidosis is treated by administering an amount to the animal therapeutically effective compound consisting of a modified oligonucleotide consisting of 20 to 30 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80.
In certain embodiments, an animal at risk of transthyretin amyloidosis or with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 linked nucleosides, where the modified oligonucleotide is complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound constituted
replaced by a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases from nucleobase sequence reported in SEQ ID NO: 80. In certain embodiments, an animal with transthyretin amyloidosis is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 linked nucleosides, where the modified oligonucleotide is 100% complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a therapeutically effective amount of a compound consisting of a modified oligonucleotide consisting of 20 linked nucleosides and having the nucleoside sequence reported in SEQ ID NO: 80. In certain embodiments, an animal with transthyretin amyloidosis. 15 is treated by administering to the animal a therapeutically effective amount of a compound consisting of a modified oligonucleotide. market consisting of 20 linked nucleosides, where the modified oligonucleotide is 100% complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1; and where the compound comprises a modified oligonucleotide consisting of 20 linked nucleosides that have the nucleobase sequence reported in SEQ ID NO: 80. In certain embodiments, an animal with transthyretin amyloidosis is treated by administering an amount of therapeutically effective use of a compound consisting of a modified oligonucleotide consisting of 20 linked nucleosides, where the modified oligonucleotide is 100% complementary to a transthyretin nucleic acid as shown in SEQ ID NO: 1; where the compound comprises a modified oligonucleotide consisting of 20 linked nucleosides having the nucleobase sequence reported in SEQ ID NO: 80; and where the modified oligonucleotides have a 10-segment segment of deoxynucleosides linked between two flanking segments that independently have 5 modified nucleosides linked.
In certain modalities, one or more numbers
modified cleosides in the flanking segment have a modified sugar. In certain modifications, the modified nucleoside is a substituted 2 "nucleoside. In certain embodiments, the modified nucleoside is a 2-MOE nucleoside.
In certain modalities, modulation can occur in a cell, tissue, organ or organism. In certain embodiments, the cell, tissue or organ is in an animal. In certain ways, it cheers you up! it is a human being. In certain embodiments, the levels of transthyretin MRNA are reduced. In certain embodiments, the levels of transthyretin protein are reduced. This reduction can occur in a time-dependent or dose-dependent manner.
Also provided are methods, compounds, and compositions useful for preventing, treating, and ameliorating diseases, disorders, and circumstances related to transthyretin amyloidosis. In certain modalities, said. 15 diseases, disorders, and circumstances are diseases, disorders, or circumstances related to transthyretin amyloidosis. r In certain modalities, treatment methods include administering an antisense TTR compound to an individual in need of it. In certain embodiments, treatment methods include administering an antisense TTR oligonucleotide to an individual in need of it.
In certain embodiments, treatment methods include administering an anti-transthyretin antisense oligonucleotide and additional therapy to an individual in need of it.
DETAILED DESCRIPTION OF THE INVENTION It should be understood that both the foregoing general description and the following detailed description are only exemplary and explanatory and not restrictive of the invention, as claimed. Here, the use of the singular includes the plural, unless specifically indicated otherwise.
As used in this document, the use of "or" means "and / or" unless otherwise indicated. In addition, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms like
"element" or "component" includes elements and components that comprise a unit and elements and components comprising more than one subunit, unless specifically indicated otherwise. The section titles used in this document are for organizational purposes only and should not be construed to limit the subject described. All documents or parts of documents, mentioned in this application, including, among others, patents, patent applications, articles, books and treaties, are expressly incorporated in this document, by reference to the parts of the document discussed here, as well as in its entirety.
DEFINITIONS Unless specific definitions are provided, the nomenclature used in relation to, and the procedures and techniques of analytical chemistry, synthetic organic chemistry and medical and pharmaceutical chemistry described in this document are those known and commonly used in the art. Techniques - 15 patterns can be used for chemical synthesis, and chemical analysis. Where permitted, all patents, orders, published orders and other publications, access numbers on GENBANK and associated sequence information obtained from databases such as the national center for biotechnology information (NCBI) among other data referenced throughout this disclosure, they are incorporated as a reference for the parts of the document discussed here, as well as in their entirety. Unless otherwise indicated, the following terms have the following meanings: "2'-O-methoxyethyl" (also 2'-MOE and 2-0 (CH> 2) -OCH; 3) refers to an O-methoxyethyl modification in the 2 'position of a furosila ring. A modified 2'-O-methoxyethyl sugar is a modified sugar. "2'-O-methoxyethyl nucleotide" means a nucleotide consisting of a modified sugar portion of 2-O-methoxyethyl. "S-methylcytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase. "Active pharmaceutical agent" means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit.
when administered to an individual. For example, in certain modalities an antisense oligonucleotide directed to transthyretin is an active pharmaceutical person. "Active target region" or "target region" means a region to which one or more active antisense compounds are targets. "Active antisense compounds" means antisense compounds that reduce target nucleic acid levels or protein levels. "Concomitantly administered" refers to the co-administration of two agents in any way in which the pharmacological effects of both are manifest in the patient at the same time. Concurrent administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or through the same route of administration. The effects of both agents need not manifest at the same time. The effects need only be overlapping .- 15 tospor for a period of time and need not be coextensive.
"Administer" means providing a pharmaceutical agent to an individual, and includes, among others, administration by a medical professional and self-administration. "Amenization" refers to a decrease in at least one indicator, sign, or symptom of a disease, a disorder, or an associated condition. The severity of the indicators can be determined by subjective or objective measures, which are known to those skilled in the art.
"Amyloidosis" is a group of diseases or disorders resulting from abnormal deposits of protein (amyloid or fibrilous amyloid) in various tissues of the body. Amyloid proteins can be deposited in a certain area of the body (localized amyloidosis) or can be deposited throughout the body (systemic amyloidosis). There are three types of systemic amyloidosis: primary (AL), secondary (AA), and familial (ATTR). Primary amyloidosis is not associated with any other disease and is considered a disease entity in its own right. Secondary amyloidosis occurs as a result of another disease. Familial Mediterranean fever is a form of amyloidosis
if familiar (inherited).
"Animal" refers to a human or a non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
Ss "Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by said target nucleic acid.
"Antisense compound" means an oligomer compound that is capable of undergoing hybridization with a target nucleic acid via hydrogen bonding.
"Anti-sense inhibition" means the reduction of target nucleic acid levels or target protein levels in the presence of an antis- compound. 15 complementary sense to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antiseptic compound.
"Antisense oligonucleotide" means the single-stranded oligonucleotide containing a sequence of nucleobases that allows hybridization to the corresponding region or segment of a target nucleic acid.
"Bicyclic sugar" means a bridge-modified furosil ring of two non-twin ring atoms. A bicyclic sugar is a modified sugar.
"Bicyclic nucleic acid" or "BNA" refers to a nucleoside — a nucleotide in which the furanosis part of the nucleoside or nucleotide includes a bridge that connects two carbon atoms in the furanose ring, forming a system of bicyclic rings.
"Cap structure" or "cap terminal portion" means chemical modifications, which have been incorporated into any terminal of a compound — antisense.
"Central Nervous System (CNS)" refers to the vertebrate nervous system that is between the meninges. It contains most of the system
nervous theme and consists of the brain (in vertebrates that have brains) and the spinal cord. The CNS is contained within the dorsal cavity, with the brain within the cranial cavity and the spine in the spinal canal. The brain is also protected by the skull and the spinal cord, in the vertebrates, is also protected by the vertebrae.
"Chemically distinct region" refers to a region of an antisense compound that is somehow chemically different from another region of the same antisense compound. For example, a region having 2-O-methoxyethyl nucleotides is chemically distinct from a region having 2'-O-methoxyethyl unchanged nucleotides. "Antisense chimeric compound" means an antisense compound that has at least two chemically distinct regions. "Choroid plexus" is the area over the brain's ventricles where cerebrospinal fluid (CSF) is produced. "Co-administration" means the administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents can be in a single pharmaceutical composition, or they can be in separate pharmaceutical compositions. The two or more pharmaceutical agents can be in a single pharmaceutical composition, or they can be separate pharmaceutical compositions. Co-administration includes parallel or sequential administration.
"Complementarity" means the ability to match between nucleobases of a first nucleic acid and a second nucleic acid.
"Contiguous nucleobases" means nucleobases immediately adjacent to each other.
"Diluent" means an ingredient in a composition that has no pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid solution, for example, saline.
"Dose" means that a certain amount of a pharmaceutical agent is delivered in a single administration, or within a specified period of time. In certain modalities, a dose can be administered in one, two, or more boluses, pills or injections. For example, in certain modalities where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated for a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week or month.
"Effective amount" means the amount of active pharmaceutical agent sufficient to effect a desired physiological result in an individual in need of the agent. The effective amount may vary between individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formula-. 15 ection of the composition, the assessment of the individual's health status and among other relevant factors. : "Familial amyloidosis" or "hereditary amyloidosis" is a form of hereditary amyloidosis. "Familial amyloid polyneuropathy" or "FAP" is a genetically transmitted neurodegenerative disorder, characterized by systemic depositions of amyloid variants of transthyretin proteins, causing progressive sensory and motor polyneuropathy.
"Completely complementary" or "100% complementary" means that each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid. "Gapmer" means an antisense chimeric compound in which —an inner region containing a plurality of nucleosides that allows for RNAse H cleavage is positioned between outer regions containing one or more nucleosides, where the nucleosides that make up the inner region are chemically distinct from the nucleoside or nucleosides that comprise the outer regions. The inner region can be referred to as a "gap segment" and the outer regions can be referred to as "flanking segments." "Gap-extended" means an antisense chimeric compound containing a segment of a range of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to the 5 'and 3' flanking segments having one to six nucleosides.
"Hereditary transthyretin amyloidosis (TTR)" is a systemic disease caused by mutations in transthyretin, a plasma transport protein of thyroxine and vitamin A. It is most often associated with peripheral neuropathy and restrictive cardiomyopathy, but amyloid deposits on the walls blood vessels and connective tissue structures throughout the body often cause dysfunction among other organ systems. 15 gals. Abnormalities of gastrointestinal motility are common in this disease with constipation, diarrhea and early satiety due to delayed gastric emptying. Amyloid deposits in the connective tissue on the wrist can cause carpal tunnel syndrome. Amyloid deposits in the spinal blood vessels and surrounding structures cause spinal stenosis with symptoms of lameness.
"Hybridization" means the pairing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
"Immediately adjacent" means that there is no intervening element between the immediately adjacent elements.
"Individual" means a human or non-human animal selected for treatment or therapy.
"Intracerebroventricular administration" or "intraventricular cerebral administration" or "Ventricular cerebral administration" means administration by injection or infusion into the brain's ventricular system.
"Intraperitoneal administration" means administration by the cavity
peritoneal activity.
"Intrathecal administration" means administration by injection or infusion with cerebrospinal fluid bHNA using the spinal cord and brain.
"Intravenous administration" means administration into a vein.
"Intraventricular administration" means administration to the ventricles of the brain or heart. "Internucleoside bond" refers to the chemical bond between nucleosides.
"Leptomeningeal" means having to do with leptomeninges, the two innermost layers of the tissues that cover the brain and spinal cord. "Leptomeningeal amyloidosis" refers to amyloidosis of leptomeninges resulting from transthyretin amyloid deposition within leptomeninges.
"Linked nucleosides" means adjacent nucleosides that are linked together.
The "Mismatch" or "non-complementary nucleobase" refers to the case when the nucleobase of a first nucleic acid is not able to match the corresponding nucleobase of a second target nucleic acid.
"Modified internucleoside bond" refers to a substitution or any change in the internucleoside bond that occurs naturally (ie, a phosphodiester internucleoside bond).
"Modified nucleobase" refers to any nucleobase except adenine, cytosine, guanine, thymidine or uracil. An "unmodified nucleobase" means purine adenine (A) and guanine (G) bases, and pyramidine thymine (T), cytosine (C), and uracil (U) bases.
"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside bond, or modified nucleobase. A "modified nucleoside" means a nucleoside independently containing a portion of modified a- —carmodified or nucleobase.
"Modified oligonucleotide" means an oligonucleotide that comprises at least one modified nucleotide.
"Modified sugar" refers to a substitution or alteration of a natural sugar. "Motive" means the pattern of chemically distinct regions in an antisense compound. "Naturally occurring internucleoside bond" means a 3 'to 5 phosphodiester bond ".
"Portion of natural sugar" means a sugar found in (2-H) DNA or (2 - OH) RNA.
"Nucleic acid" refers to molecules composed of monomeric nucleotides - A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering nucleic acids (siRNA) and mMicroRNAs (myRNA). A nucleic acid can also include a combination of these elements in a single molecule.
2. "Nucleobase" means a heterocyclic group capable of pairing with a base of another nucleic acid.
7 "Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, nucleotide binding or modification.
"Nucleoside" means a nucleobase attached to a sugar.
"Nucleotide" means a nucleoside containing a phosphate group covalently attached to the sugar part of the nucleoside.
"Oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits that is capable of hybridizing to at least one region of a nucleic acid molecule.
"Oligonucleotide" means a polymer of linked nucleosides, each of which can be modified or unmodified, independent of each other.
"Parenteral administration" means administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration or intracranial administration.
na, for example, intracerebral administration, intrathecal administration, ventricular administration, ventricular administration, intra-cerebroventricular administration, cerebral ventricular administration or cerebral ventricular administration. Administration can be continuous, or chronic, or short or intermittent.
"Peptide" means a molecule formed by the bonding of at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.
"Pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can include one or more pharmaceutical agents and a sterile aqueous solution.
"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, that is, - 15 salts want the desired biological activity of the parent oligonucleotide and do not confer on them the respective undesirable toxicological effects. "Phosphorothioate bond" means a bond between nucleosides where the phosphodiester bond is modified by replacing one of the non-bonding oxygen atoms with a sulfur atom. A thiophosphate bond is a modified internucleoside bond.
"Part" means a defined number of contiguous (i.e., linked) nucleobases of nucleic acids. In certain embodiments, a part is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a part is a defined number of nucleobases - contiguous to an antisense compound.
"Prevent" refers to delaying or preventing the onset or development of a disease, disorder or condition for a period of time from minutes to indefinitely. Prevention also means reducing the risk of developing a disease, disorder or condition.
"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells by the action of endogenous enzymes or other chemicals or conditions.
"Side effects" means physiological responses attributed to treatment other than the desired effects. In certain modalities, side effects include reactions at the injection site, abnormalities in the liver function test, abnormalities in kidney function, liver toxicity, renal toxicity, abnormalities in the central nervous system, myopathies and malaise. For example, increased levels of serum aminotransferase may indicate liver toxicity or abnormal liver function. For example, increased bilirubin may indicate liver toxicity or abnormal liver function.
"Single-stranded oligonucleotide" means an oligonucleotide that is not hybridized to a complementary strand.
"Specifically hybridizable" refers to an "antisense" compound with a sufficient degree of complementarity between an oligonucleotide. 15 antisense and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids: under conditions where specific binding is desired, that is, under physiological conditions in the case of in vitro assays and therapeutic treatments.
"Subcutaneous administration" means administration just below the "Marking" or "marked" skin means that the process of designing and selecting an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect. "Target nucleic acids," "Target RNA" and "transcribed target RNA" all refer to a nucleic acid capable of being targeted by antisense compounds. "Target segment" means the nucleotide sequence of a target nucleic acid for which an antisense compound is marked. "Target site 5" refers to the nucleotide that is at the 5 'end of a target segment. "Target site 3" refers to the nucleotide that is at the 3 'end of a target segment. "Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
residual.
"Specific transthyretin inhibitor" or "transthyretin inhibitor" means a compound capable of decreasing the expression of mRNA or transthyretin protein. Examples of said compounds include a nucleic acid, a peptide, an antibody or a histone deacetylase inhibitor.
"Specific transthyretin modulator" or "transthyretin modulator" means a compound capable of decreasing the expression of mMRNA or transthyretin protein.
"Transthyretin-related amyloidosis" or "Transthyretin amyloidosis" or "transthyretin amyloid disease", as used herein, is any pathology or disease associated with transthyretin dysfunction or dysregulation that results in the formation of amyloid fibrils containing transthyretin. Transthyretin amyloidosis includes, among others, TDA amyloidosis, melanocytosis, familial amyloid polyneuropathy (FAP), .- 15 familial amyloid cardiomyopathy, familial amyloidosis, senile cardiac amyloidosis or senile systemic amyloidosis.
: "Treating" refers to administering a pharmaceutical composition to effect a change or amelioration of a disease, disorder or condition.
"Unmodified nucleotide" means a nucleotide composed of naturally occurring nucleobases, sugar moieties and internucleoside bonds. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e., B-D-ribonucleosides) or a DNA nucleotide (i.e., B-D-deoxyribonucleoside).
Certain modalities Certain modalities provide methods, compounds, and compositions for inhibiting transthyretin expression.
Certain modalities provide antisense compounds targeting a transthyretin nucleic acid. In certain embodiments, transthyretin nucleic acid is any of the access number sequences in GENBANK NM 000371.2 (incorporated here as SEQ ID NO: 1), GENBANK NT 010966.10 accession number truncated from nucleotides -
deos 2009236 through 2017289 (incorporated herein as SEQ ID NO: 2); exons 1-4 extracted from the genome sequence of the rhesus monkey accession number in GENBANK NW 001105671.1, based on similarity to human exons; and GENBANK access number. NW 001105671.1 truncated from - nucleotides 628000 to 638000 (incorporated here as SEQ ID NO: 4).
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 8 to 80 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from a sequence selected from among the nucleobase sequences reported in SEQID NOs: 25, 80, 86, 87, 115, 120, 122, and 124. In certain ways, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases from a selected sequence of - 15 between nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115 , 120, 1220124.
e Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 12 to 50 nucleosides where the linked nucleosides comprise at least 8, at least 9, at least 10, at least 11, at least 12, at least 13 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases from a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122 and 124. In certain embodiments, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 , at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from the nucleotide sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115 , 120, 122 and 124.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 12 to 30 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86 , 87, 115, 120, 122 and 124. In certain modalities, the modified oligonucieotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases from a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122 and 124. Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 15 to 25 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from a sequence selected from among the relative nucleobase sequences minutes in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122 and 124.
Certain embodiments provide compounds comprising an o-. 15 modified ligonucleotide consisting of 18 to 21 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from: a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120 , 122 and 124. In certain modalities, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 14, at least 15, at least 16, at least 16 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122 and 124.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 8 to 80 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80 , 86, and 87. In certain embodiments, the modified oligonu- —cleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from among the sequences
nucleobase types reported in SEQ ID NOs: 25, 80, 86, and 87. Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 12 to 50 nucleosides where the linked “nucleosides comprise at least 8 contiguous nucleobases of a selected sequence among the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, and 87. In certain embodiments, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from among the sequences
nucleobase types reported in SEQ ID NOs: 25, 80, 86, and 87. Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 12 to 30 nucleosides where the -— 15 linked nucleosides comprise at least 8 contiguous nucleobases in a sequence selected from among the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, and 87. In certain embodiments, the modified oligonucleotide comprises at least 9, at least 10, at least 11 at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from among the sequences
nucleobase types reported in SEQ ID NOs: 25, 80, 86, and 87. Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 15 to 25 nucleosides where the linked - nucleosides comprise at least 8 contiguous nucleobases of a selected sequence among the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, and 87. In certain embodiments, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from among the sequences
nucleobase copies reported in SEQ ID NOs: 25, 80, 86, and 87.
Certain embodiments provide compounds comprising a modified o-ligonucleotide that consists of 18 to 21 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from a sequence selected from the nucleobase sequences reported in SEQID NOs: 25, 80, 86, and 87 In certain embodiments, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, and 87.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 8 to 80 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80. In certain modalities, the modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 , or at least 20 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID NO: 80.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 12 to 50 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from the nucleobase sequence reported in SEQ ID NO: 80. In certain modalities, the modified oligonucleotide comprises, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleobases contiguous from a sequence selected from among the nucleobase sequences reported in SEQ ID NO: 80.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 12 to 30 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from the nucleobase sequence reported in SEQ ID NO: 80. In certain modalities,
The modified oligonucleotide comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least at least 19, or at least 20 contiguous nucleobases from a selected sequence of inter-nucleobase sequences reported in SEQ ID NO: 80.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 15 to 25 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from the nucleobase sequence reported in SEQ ID NO: 80. In certain modalities, the modified oligonucleotide comprises, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID Ns: 80.
«Certain modalities provide compounds comprising a modified o-ligonucleotide consisting of 18 to 21 nucleosides where the bound 6 nucleosides comprise at least 8 contiguous nucleobases of the nucleobase sequence reported in SEQ ID NO: 80. In certain modalities, the oligonucleotide modified comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least minus 20 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID NO: 80.
Certain embodiments provide compounds comprising a modified o-ligonucleotide consisting of 20 to 30 nucleosides where the linked nucleosides comprise at least 8 contiguous nucleobases from the nucleobase sequence reported in SEQ ID NO: 80. In certain modalities, the modified oligonucleotide comprises, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleobases in one nucleobase sequence reported in SEQ ID NO: 80.
In certain embodiments, the compound comprises a modified oligonucleotide that consists of 20 linked nucleosides reported in SEQ ID NO: 80.
Certain embodiments provide compounds that comprise a modified oligonucleotide consisting of 12 to 30 linked nucleosides where the linked nucleosides comprise at least a portion of 8 contiguous nucleobases that is complementary to a portion of nucleobases of equal length within the selected 120- nucleotide region. 139, 212-236, 226-245, 293-468, 2093-326, 347-381, 425-468, 425-467, 452-478, 452-474,459-478, 461-519, 462-500, 500- 519, 535-501, 502-531, 505-524, 507-526508-527, 514-540, 514-539, 515-534, 516-535, 523-542, 544-606, 544-564, 564- 583, 578-601, 580-608, 580-599, 606 584, 585-604, 587-606 or 597-617 SEQ ID NO: 1. In certain modalities the region is selected from 507-526, 508-527, 515-534, 516-535, 580-599, 585-604, 587-606 and 589-. 15 608daSEQ1D NO: 1. In certain modalities the region is selected from 501-535 or 580-608 of SEQ ID NO: 1. In certain modalities, the modified oligonucleotide has a part of at least about 9, at least one- but 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases of which it is complementary within a region described here. Certain embodiments provide compounds that comprise a modified oligonucleotide consisting of 12 to 30 linked nucleosides where the linked nucleosides comprise at least a portion of 8 contiguous nucleobases that is complementary to a portion of nucleobases of equal length within the selected nucleotide region 501-535 or 580-608 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide has a portion of at least 9, at least 10, at least 11, at least 12, at least 13, at least at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleus
contiguous bases that is complementary within a region described here. Certain embodiments provide compounds that comprise a modified oligonucleotide that consists of 12 to 30 linked nucleosides where the linked nucleosides comprise at least a part of 8 — contiguous nucleosides that is complementary to a part of nucleobases of equal length within the selected region of 508- nucleotides 527 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide has a portion of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases of which it is complementary within a region described here.
Certain embodiments provide compounds that comprise a modified oligonucleotide that consists of 15 to 25 linked nucleosides. 15 where the linked nucleosides comprise at least a portion of 8 contiguous nucleobases that is complementary to a portion of nucleobases of equal length within the selected region of nucleotides 507-526, 508-527, 515-534, 516-535, 580-599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide has a part of at least 9, at least 10, at least 11, at least 12, at least some 13, at least some 14, at least some 15, at least some 16, at least some 17, at least some 18, at least some 19 or at least some 20 contiguous nucleobases of which it is complementary within a region described on here.
Certain embodiments provide compounds that comprise a modified oligonucleotide that consists of 18 to 21 linked nucleosides where the linked nucleosides comprise at least a part of 8 contiguous nucleobases that is complementary to a part of nucleobases of equal length within the selected nucleotide region 507-526 , 508-527,515-534, 516-535, 580-599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide has a part of at least about 9, at least at least 10, at least 11,
at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases of which is complementary within a region described here.
Certain embodiments provide compounds that comprise a modified oligonucleotide consisting of 20 linked nucleosides where the linked nucleosides comprise at least a portion of contiguous nucleotides that is complementary to a portion of nucleobases of equal length within the selected nucleotide region 507-526 , 508-527,515-534, 516-535, 580-599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide has a part of at least about 9, at least at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at .-— 15 minus 19 or at least 20 contiguous nucleobases of which it is complementary within a region described here. In certain embodiments, the modified oligonucleotide is 90%, 95%, 99%, or 100% complementary to a nucleic acid encoding human transthyretin (TTR), for example. SEQ ID No: 1.
Certain embodiments provide compounds that comprise a modified oligonucleotide that consists of 20 linked nucleosides where the linked nucleosides comprise at least a portion of contiguous nucleotides that is complementary to a portion of nucleobases of equal length within the selected region of nucleotides 508-527 SEQ IDNO: 1. In certain embodiments, the modified oligonucleotide has a part of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least in the 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases that are complementary to a part of equal length within the selected region of nucleotides 508-527 from SEQ ID NO: 1. In certain corporations, the modified oligonucleotide is 90%, 95%, 99%, or 100%
complementary to a nucleic acid encoding human transthyretin (T-TR), for example. SEQ ID No: 1.
Certain embodiments provide compounds that comprise a modified oligonucleotide that consists of 20 linked 60% complementary nucleosides within the selected nucleotide region 507-526, 508-527, 515-534, 516-535, 580-599, 585-604, 587- 606 and 589-608 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 20 70% complementary linked nucleosides within the selected nucleotide region 507-526, 508-527, 515-534, 516-5 535, 580-599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1. Certain embodiments provide compounds that comprise a modified oligonucleotide consisting of 20 80% linked nucleosides. 15 complementary within the selected nucleotide region 507-526, 508-527, 515-534, 516-535, 580-599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 20 nucleosides linked 90% complementary within the selected nucleotide region 507-526, 508-527, 515-534, 516-535, 580-599, 585-604, 587-606 and 589- 608 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 20 95% complementary linked nucleosides within the selected nucleotide region 507-526, 508-527, 515-534, 516-535, 580- 599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 20 nucleosides linked 99% complementarily within the selected nucleotide region 507-526, 508- 527, 515-534, 516-535, 580-599, 585-604, 587-606 and 589-608 of SEQ ID NO: 1.
Certain embodiments provide compounds that comprise a modified oligonucleotide that consists of 20 linked 100% complementary nucleosides within the selected nucleotide region 507-526, 508-527, 515-534, 516-535, 580-599, 585-604, 587- 606 and 589-608 of SEQ ID
NOT Certain modalities provide compounds that comprise a modified oligonucleotide that consists of 20 nucleosides linked 60% complementary within nucleotides 508-527 of SEQ ID NO: 1. Certain modalities provide compounds that comprise a modified oligonucleotide that consists of 20 nucleosides linked 70% complementary within nucleotides 508-527 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 20 nucleosides linked 80% complementary within nucleotides 508-527 of SEQ ID NO: 1.: 15 Certain embodiments provide compounds which comprise a modified oligonucleotide consisting of 20 complementary 90% linked nucleosides within nucleotides 508-527 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 20 95% complementary linked nucleosides within 508 nucleotides -527 of SEQ ID NO: 1. Certain modalities provide compositions which comprise a modified oligonucleotide consisting of 20 99% complementary linked nucleosides within nucleotides 508-527 of SEQ ID NO: 1. Certain embodiments provide compounds comprising a modified —oligonucleotide consisting of 20 complementary 100% linked nucleosides within the nucleotides 508-527 of SEQ ID NO: 1. In certain embodiments, an antisense compound or a modified oligonucleotide targeting a transthyretin nucleic acid is targeted to the following nucleotide regions of SEQ ID NO: 1. 120- 139,212-236,226- 245, 293-468, 293-326, 347-381, 425-468, 425-467, 452- 478, 452-474, 459-478, 461-519, 462-500, 500-519, 502-531, 507-526, 505-524, 508-527, 514-540, 514-539, 515-534, 516-535, 523-542, 544-606, 544-
564, 564-583, 578-601, 580-599, 584-606, 585-604, 587-606, or 597-617. In certain embodiments, an antisense compound or modified oligonucleotides is directed to a region of a transthyretin nucleic acid. In certain embodiments, said compounds or oligonucleotides labeled for a region of a transthyretin nucleic acid have a part of contiguous nucleobases that is complementary to a part of nucleobases of equal length to the region. For example, the part may be a part of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases complementary to a part of length equal to one region reported here. In certain embodiments, said compounds or oligonucleotides are tagged to the following nucleotide regions of SEQ ID NO: 1. 120-139, 212-236, 226-245, 293-381, 293-366, 353-381, 293- 468, 425-468, 425-467, 452-476, 461-481, 461-500, 500-519, 461-519, 502-531, 502-539, 504-536, 505-525, 506-530 , 507-527, 508-527, 508-536, 514-540, 15 523-542,544-606, 544-564, 544-583, or 597-617. In certain embodiments, said compounds or oligonucleotides "labeled for a region of a transthyretin nucleic acid have a part of contiguous nucleobases that is complementary to a part of nucleobases of equal length to region 501-535 or 580-608 of SEQ ID NO: 1 In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when marked by antisense or oligonucleotide compounds, show at least 60% inhibition: 226-245, 293-366, 357-467 , 452-474, 457-476, 459-478, 462-500, 500-519, 502-531, 504-536, 505-525, 506-530, 507-527, 508-527, 508-536, 514 -539, 544-564, 564-583, 578-601, 584-606, or 597-617. In certain embodiments, to the following nucleotide regions of SEQ ID NO: 1, when they are targets of antisense compounds or olignucleo- tides, shows at least 65% inhibition: 293-366, 357-376, 425-449, 432-467,452-474, 459-478, 462-500, 500-519, 502-531, 504-536, 505- 525, 506-530, 507-527, 508-527, 508-536, 514-539, 544-563, 564-583, 578-
601.585-606, or 597-617.
In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when marked by antisense or oligonucleotide compounds, show at least 70% inhibition: 293-366, 425-449, 432-467, 452- 474, 459-478, 462-500, 500-519, 502-531, 504-536, 505-525, 506-530,507-527, 508-527, 508-536, 514-539, 564-583, 578- 598, 581-600, or 597-617. In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when marked by antisense or oligonucleotide compounds, show at least 75% inhibition: 293-322, 347-366, 425-449,432-467,452- 474, 459-478, 462-500, 500-519, 503-531, 504-536, 505-525, 506-530, 507-527, 508-527, 508-536, 514-539, 578-598, 581-600, or 597-616. In certain embodiments, the following nucleotide regions of f SEQ ID NO: 1, when they are marked by antisense or olive compounds. 15 - gonucleotides, shows at least 80% inhibition: 303-322, 425-449, 432-460, 443-467, 452-473, 481-500, 500-519, 503-531, 504-536, 505- 525, IS 506-530, 507-527, 508-527, 508-536, 514-536, 519-539, 579-598, 581-600, or 597-616. In certain embodiments, the following nucleotide regions of SEQID NO: 1, when marked by antisense or oligonucleotide compounds, show at least 85% inhibition: 427-449, 432-458, 441-460, 443-467 , 452-473, 504-531, 504-536, 505-525, 506-530, 507-527, 508-527, 508-536, 514-536, 519-539, or 581-600. In certain embodiments, the following nucleotide regions of SEQID NO: 1, when marked by antisense or oligonucleotide compounds, show at least 90% inhibition: 428-449, 432-456, 439-458, 441-460 , 445-466, 452-473, 504-525, 508-527, or 515-536. In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when marked by antisense or oligonucleotide compounds, show at least 95% inhibition: 434-453, 436-456, 441-460, 445 -465, 505-524, or 516-535. In certain embodiments, the following antisense compounds are labeled for a region of SEQ ID NO: 1, a nucleic acid encoding human transthyretin, and exhibits at least 60% inhibition of a transthyretin mRNA: ISIS NOs: .420954, 420904, 304286, 420874, 420948, 420883, 420955, 420952, 420956, 420957, 420882, 420947, 420950, 304312, 304307, 420879, 420910, 420902, 420908, 420924, 420877, 420880, 304309, 304289, 420906, 3043 420878, 420911, 304284, 304288, 420909, 304296, 420949, 304290, 304299, 420898, 420920, 420925, 420951, 304287, 420894, 420916, 420918, 420926, 304285, 420919, 420923, 420886, 420900, 420912, 420900 420917, 420921, 420884, 420885, 420887, 420889, 420892, 420901, 420914, 420897, 420899, 420888, 420895, 420896, 420913, 420922, 420893, 420890, or 420891.
In certain embodiments, the following antisense compounds are T-labeled for a region of SEQ ID NO: 1, a nucleic acid that. 15 encodes human transstyretin, and has at least 65% inhibition of | a transthyretin mRNA: ISIS NOs: 420955, 420952, 420956, 420957,: 420882, 420947, 420950, 304312, 304307, 420879, 420910, 420902, 420908, 420924, 420877, 420880, 304309, 304289, 420906, 304311, 420906, 304311 , 420911, 304284, 304288, 420909, 304296, 420949, 304290, 304299, 420898, 420920, 420925, 420951, 304287, 420894, 420916, 420918, 420926, 304285, 420919, 420923, 420886, 420900, 420912, 420915 , 420921, 420884, 420885, 420887, 420889, 420892, 420901, 420914, 420897, 420899, 420888, 420895, 420896, 420913, 420922, 420893, 420890, or 420891.
In certain embodiments, the following antisense compounds are labeled for a region of SEQ ID NO: 1, a nucleic acid encoding human transthyretin, and exhibits at least 70% inhibition of a transthyretin mRNA: ISIS NOs: 304312, 304307 , 420879, 420910, 420902, 420908, 420924, 420877, 420880, 304309, 304289, 420906, 304311, 420878, 420911, 304284, 304288, 420909, 304296, 420949, 304290, 304299, 420898, 420920, 420928, 420951 , 420894, 420916, 420918, 420926, 304285, 420919, 420923, 420886, 420900,
420912, 420915, 420917, 420921, 420884, 420885, 420887, 420889, 420892, 420901, 420914, 420897, 420899, 420888, 420895, 420896, 420913, 420922, 420893, 420890, or 420891. In certain embodiments, the following compounds antisense cells are labeled for a region of a SEQ ID NO: 1, a nucleic acid encoding human transthyretin, and exhibits at least 75% inhibition of a transthyretin mRNA: ISIS NOs: 420877, 420878, 420880, 304284, 304285, 420884, 420885, 420886, 420887, 420888, 420889, 420890, 420891, 304287, 420892, 304288, 420893, 304289, 304290, 420894, 420895, 420896, 420897, 420898, 420899, 420900, 420901, 420902, 420906, 420902 304296, 420909, 420911, 420912, 420913, 420914, 304299, 420915, 420916, 420917, 420918, 420919, 420920, 420921, 420922, 420923, 420924, 420925, 420926, 304309, 420949, 420951, or: 304311. * 15 In certain embodiments, the following antisense compounds are labeled for a region of SEQ ID NO: 1, a nucleic acid that encodes transtirret human enzyme, and exhibits at least 80% inhibition of a transthyretin mRNA: ISIS NOs: 304311, 420878, 420911, 304284, 304288, 420909, 304296, 420949, 304290, 304299, 420898, 420920, 420925, 420951, 304287, 420894, 420916, 420918, 420926, 304285, 420919, 420923, 420886, 420900, 420912, 420915, 420917, 420921, 420884, 420885, 420887, 420889, 420892, 420901, 420914, 420897, 420899, 420888, 420895, 420898, 420895 420913, 420922, 420893, 420890, or
42089.
In certain embodiments, the following antisense compounds are labeled for a region of SEQ ID NO: 1, a nucleic acid encoding human transthyretin, and exhibits at least 85% inhibition of a transthyretin mRNA: ISIS NOs: 304290, 304299 , 420898, 420920, 420925, 420951, 304287, 420894, 420916, 420918, 420926, 304285, 420919, 420923, 420886, 420900, 420912, 420915, 420917, 420921, 420884, 420885, 420887, 420889, 420892, 420901 , 420897, 420899, 420888, 420895, 420896, 420913, 420922, 420893, 420890, or
420891.
In certain embodiments, the following antisense compounds are labeled for a region of SEQ ID NO: 1, a nucleic acid encoding human transthyretin, and exhibits at least 90% inhibition of a transthyretin mRNA: ISIS NOs: 420923, 420886 , 420900, 420912, 420915, 420917, 420921, 420884, 420885, 420887, 420889, 420892, 420901, 420914, 420897, 420899, 420888, 420895, 420896, 420913, 420922, 420893, 420890, or 420891. In certain embodiments, the following antisense compounds are labeled for a region of SEQ ID NO: 1, a nucleic acid encoding human transthyretin, and exhibits at least 95% inhibition of a transthyretin mRNA: ISIS NOs: 420888, 420895, 420896, 420913 , 420922, 420893, 420890, or 420891. In certain embodiments, a target region is nucleotides 120-139> 15 of SEQIDNO: 1. In certain embodiments, an antisense compound is marked for nucleotides 120-139 of SEQ ID NO : 1. In certain modalities, an antisense compound marked for an acid Transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NO: 37. In certain embodiments, an antisense compound is labeled for nucleotides 120-139 of SEQ ID NO: 1 is selected from ISIS NO:
420872.
In certain embodiments, a target region is nucleotides 212-236 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 212-236 of SEQ ID NO: 1. In certain mo- Antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 8 and 38. In certain embodiments, an antisense compound is labeled for nucleotides 212-236 of SEQ ID NO: 1 is selected from ISIS NOs : 420873 or 304267.
In certain embodiments, a target region is nucleotides 226-245 of SEQ ID NO: 1. In certain embodiments, an antisense compound is targeted for nucleotides 226-245 of SEQ ID NO: 1. In certain embodiments,
an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NO: 39. In certain embodiments, an antisense compound is labeled for nucleotides 226-245 of SEQ ID NO: 1 is selected from ISIS NO: 420874. In certain embodiments, a target region is nucleotides 293-381 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 293-381 of SEQ ID NO: 1. In certain fashion- liabilities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 10.42-48. In certain embodiments, an antisense compound is assigned to nucleotides 293-381 of SEQ ID NO: 1 is selected from ISIS NOs: 420877, 420878, 420879, 420880, 304280, 420881, 420882, or
420883. - In certain embodiments, a target region is the nucleotides - 15 293-366 daSEQIDNO: 1. In certain embodiments, an antisense compound 'is marked for nucleotides 293-366 of SEQ ID NO: 1. In certain modalities , an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 42-45. In certain embodiments, an antisense compound is labeled for nucleotides 293-366 of SEQ ID NO: 1 is selected from ISIS NOs: 420877, 420878, 420879, or 420880. In certain embodiments, a target region is nucleotide 353-381 from SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 353-381 of SEQ ID NO: 1. In certain conditions, an antisense compound labeled for a transthyretin nucleic acid comprises a sequence of nucleobases selected from SEQ ID NOs: 10, 46-48. In certain embodiments, an antisense compound is labeled for nucleotides 353-381 of SEQ ID NO: 1 is selected from ISIS NOs: 304280, 420881, 420882, or 420883. In certain embodiments, a target region is nucleotide 293-468 from SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 293-468 of SEQ ID NO: 1. In certain instances
dalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 10-18, 42-63. In certain embodiments, an antisense compound is labeled for nucleotides 293-468 of SEQ ID NO: 1 is selected doliSISNOs: 420877, 420878, 420879, 420880, 304280, 420881, 420882, 420883, 304284, 304285, 420884, 420885 , 304286, 420886, 420887, 420888, 420889, 420890, 420891, 304287, 420892, 304288, 420893, 304289, 304290, 420894, 420895, 420896, 420897, 420898, or 304291. In certain embodiments, a target region is the nucleotides 425-468daSEQID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 425-468 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a sequence of nucleobases selected from - SEQ ID NOs: 11-18, 49-63. In certain embodiments, an antisensor compound. 15 is only marked for nucleotides 425-468 of SEQ ID NO: 1 is selected: from ISIS NOs: 420877, 420878, 420879, 420880, 304280, 420881, 420882, fr 420883, 304284, 304285, 420884, 420885, 304286, 420886 , 420887, 420888, 420889, 420890, 420891, 304287, 420892, 304288, 420893, 304289, 304290, 420894, 420895, 420896, 420897, 420898, or 304291. In certain embodiments, a target region is nucleotide 425-467 da SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 425-468 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a selected nucleobase sequence from SEQIDNOs: 11-17, 49-63. In certain embodiments, an antiseptic compound is labeled for nucleotides 425-468 of SEQ ID NO: 1 is selected from ISIS NOs: 304284, 304285, 420884, 420885, 304286, 420886, 420887, 420888, 420889, 420890, 420891 , 304287, 420892, 304288, 420893, 304289, 304290, 420894, 420895, 420896, 420897 or 420898.
In certain embodiments, a target region is nucleotides 452-476 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 452-476 of SEQ ID NO: 1. In certain moieties
dalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 64-69. In certain embodiments, an antisense compound is labeled for nucleotides 452-476 of SEQ ID NO: 1 is selected from ISIS NOs: 420889, 420890, 420891, 304287, 420892, 304288, 420893, 304289, 304290, 420894, 420895, 420896 , 420897, 420898, 304291, 304292, 304293, 420899, 420900, 420901, 420902, 420903, or 420904. In certain embodiments, a target region is nucleotides 461-481 of SEQ ID NO: 1. In certain embodiments, a compound antisense is labeled for nucleotides 461-481 of SEQ ID NO: 1. In certain modalities, an antisense labeled compound for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 72-73. In certain embodiments, an antisense compound is labeled for nucleotides 461-481 of SEQ ID NO: 1 is selected from. 15 1ISISNOs: 420907 or 420908. D In certain embodiments, a target region is nucleotides: 461-500 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 461-500 of SEQ ID NO: 1 In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 22, 72 and 73. In certain embodiments, an antisense compound is labeled for nucleotides 461-500 of SEQ ID NO: 1 is selected from ISIS NOs: 420907, 420908 or 304296. In certain embodiments, a target region is nucleotides 500-519 of SEQID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 500-519 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NO: 74. In certain embodiments, an antisense compound is labeled for the nucleotides 500-519 SEQ ID NO: 1 is selected from ISIS NO: 420909. In certain embodiments, a target region is the nucleotides
461-519 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 461-519 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQIDNOs: 22,23,72-74. In certain embodiments, an antiseptic compound is labeled for nucleotides 461-519 of SEQ ID NO: 1 is selected from ISIS NOs: 420907, 420908, 304296, or 420909. In certain embodiments, a target region is 502- 531 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 502-531 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a sequence of selected nucleobases from SEQ ID NOs: 25, 75-84. In certain embodiments, an antisense compound is labeled for nucleotides 502-531 of SEQ ID NO: 1 is selected from. 15 ISIS NOs: 420910, 420911, 420912, 420913, 420914, 304299, 420915, '420916, 420917, 420918, or 420919. 7 In certain embodiments, a target region is nucleotides 502-539 of SEQ ID NO: 1. In In certain embodiments, an antisense compound is labeled for nucleotides 502-539 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 25, 26, 75-91. In certain embodiments, an antiseptic compound is labeled for nucleotides 502-539 of SEQ ID NO: 1 is selected from ISIS NOs: 420910, 420911, 420912, 420913, 420914, 304299, 420915, 420916, 420917, 420918, 420919 , 304300, 420920, 420921, 420922, 420923, 420924, 420925, or 420926.
In certain embodiments, a target region is nucleotides 504-536 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 504-536 of SEQ ID NO: 1. In certain modalities, a compound labeled antisense for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 25, 26, 77-88. In certain embodiments, an anti-essential compound
so is tagged for nucleotides 504-536 of SEQ ID NO: 1 is selected from ISIS NOs: 420912, 420913, 420914, 304299, 420915, 420916, 420917, 420918, 420919, 304300, 420920, 420921, 420922, or 420923. In certain embodiments, a target region is nucleotides 505-535 of SEQID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 505-535 of SEQ ID NO: 1. In certain modalities, a marked antisense compound for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 25, 26, 78-87. In certain embodiments, an antisense compound is labeled for nucleotides 505-535 of SEQ ID NO: 1 is selected from ISIS NOs: 420913, 420914, 304299, 420915, 420916, 420917, 420918, 420919, 304300, 420920, 420921, or 420922. In certain embodiments, a target region is nucleotides. 506-530 of SEQ ID NO: 1. In certain embodiments, an antisense compound .— 15 is labeled for nucleotides 506-530 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a nucleic acid in transthyretin comprises a nucleobase sequence selected from SEQ ID NOs: 25, 79-83. In certain embodiments, an antisense compound is labeled for nucleotides 506-530 of SEQ ID NO: 1 is selected from ISIS NOs: 420913, 420914, 304299, 420915, 420916, 420917, 420918, or
420919. In certain embodiments, a target region is nucleotides 507-527 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 507-527 of SEQ ID NO: 1. In certain mo- , an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 25 or 80. In certain embodiments, an antisense compound is labeled for nucleotides 507-527 of SEQ ID NO: 1 is selected from ISIS NO: 304299 or 420915. In certain embodiments, a target region is nucleotides 508-527 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 508-527 of SEQ ID NO: 1. In certain mo-
dalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NO: 80. In certain embodiments, an antisense compound is labeled for nucleotides 508-527 of SEQ ID NO: 1 is selected of ISIS NO: 420915. In certain embodiments, a target region is nucleotides 514-540 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 514-540 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 85-92. In certain embodiments, an antisense compound is labeled for nucleotides 514-540 of SEQ ID NO: 1 is selected from ISIS NOs: 420920, 420921, 420922, 420923, 420924, 420925, 420926, or r 420927.
. 15 In certain embodiments, a target region is nucleotides 523-542 of SEQ ID NO: 1. In certain embodiments, an antisense compound * is labeled for nucleotides 523-542 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQID NO: 94. In certain embodiments, an antisense compound is labeled for nucleotides 523-542 of SEQ ID NO: 1 is selected from ISIS NO : 420929. In certain embodiments, a target region is nucleotides 544-606 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 544-606 of SEQ ID NO: 1. In certain modalities , an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 30-33, 112-122. In certain embodiments, an antisense compound is labeled for nucleotides 544-606 of SEQ ID NO: 1 is selected from ISIS NOs: 420947, 420948, 304304, 304307, 304308, 304309, 420949, 420950, 420951, 420952 , 420953, 420954, 420955, 420956, or
420957.
In certain embodiments, a target region is nucleotides 544-564 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 544-564 of SEQ ID NO: 1. In certain modalities, a compound labeled antisense for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 112-113. In certain embodiments, an antisense compound is labeled for nucleotides 544-564 of SEQ ID NO: 1 is selected from ISIS NOs: 420947 or 420948. In certain embodiments, a target region is nucleotides - 544-583 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 544-583 of SEQ ID NO: 1. In certain modalities, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from - SEQ ID NOs: 30, 31, 112, and 113. In certain embodiments, a compound an-. 15 tissenso is labeled for nucleotides 544-583 of SEQ ID NO: 1 is selected from ISIS NOs: 420947, 420948, 304304, or 304307. is In certain embodiments, a target region is nucleotides 597-617 of SEQ ID NO: 1. In certain embodiments, an antisense compound is labeled for nucleotides 597-617 of SEQ ID NO: 1. In certain conditions, an antisense compound labeled for a transthyretin nucleic acid comprises a nucleobase sequence selected from SEQ ID NOs: 34-35. In certain embodiments, an antisense compound is labeled for nucleotides 597-617 of SEQ ID NO: 1 is selected from ISIS NOs: 304311 or 304312. In certain embodiments, the modified oligonucleotide consists of a modified single-stranded oligonucleotide.
In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.
In certain embodiments, the nucleobase sequence of the modified oligo- nucleotide is at least 90% complementary over its full length to a nucleobase sequence of SEQ ID NO: 1, 2, or 4. In certain embodiments, the sequence of nucleobases of the modified oligonucleotide is at least 95% complementary over its full length to a nucleobase sequence of SEQ ID NO: 1,2, or 4. In certain embodiments, the modified oligonucleotide is at least 99% complementary over its full length to SEQ ID NO: 1, 2, or 4. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary over its full length to a nucleobase sequence of SEQ ID NO: 1,2, or 4 In certain embodiments, the compound has at least one modified internucleoside bond. In certain embodiments, the internu- nucleoside bond is an internucleoside thiophosphate bond. In certain embodiments, the compound has at least one nucleoside containing a modified sugar. In certain embodiments, at least the modified sugar is a bicyclic sugar. In certain modalities, at least. in bicyclic sugar it comprises a 4-CH (CH3) -O-2 'bridge. In certain embodiments, at least one modified sugar comprises one: 2'-O-methoxyethyl.
In certain embodiments, the compound comprises at least one modified tetrahydropyran nucleoside where a tetrahydropyran ring replaces the furanose ring. In certain embodiments, at least the modified tetrahydropyran nucleoside has the structure: oro where Bx is an optionally protected heterocyclic base portion In certain embodiments, the compound has at least one nucleoside comprising a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified compound oligonucleotide comprises: (i) a gap segment consisting of bound deoxynucleosides; (ii) a 5 'flanking segment consisting of nucleosides | i- | cattle; (iii) a 3 'flanking segment consisting of nucleosides | hinged, where the gap segment is positioned between the 5' flanking segment and the 3 'flanking segment and where each ca-nucleuside of the flanking segment comprises a sugar modified.
In certain embodiments, the modified compound oligonucleotide comprises: () a gap segment consisting of ten linked deoxynucleotides; (ii) a 5 'flanking segment consisting of five linked nucleosides; (iii) a 3 'flanking segment consisting of five linked nucleosides, where the gap segment is positioned immediately * adjacent to, and between the 5' flanking segment and the 3 'flanking segment, - 15 wavy nucleoside of each segment flanking comprises a 2-O-methoxyethyl sugar; and where each internucleoside bond is a thiophosphate bond.
In certain embodiments, the modified compound oligonucleotide comprises: (i) a gap segment consisting of eight deoxynucleotides linked; (ii) a 5 'flanking segment consisting of six linked nucleosides; (iii) a 3 'flanking segment consisting of six linked nucleosides, where the gap segment is positioned immediately adjacent to, and between the 5' flanking segment and the 3 'flanking segment, where each nucleoside of each flanking segment comprises a 2-O-methoxyethyl sugar; and where each internucleoside bond is a thiophosphate bond. In certain embodiments, the modified oligonucleotide of the compound comprises: () an interval segment consisting of eight deoxynucleotides
linked sids; (ii) a 5 'flanking segment consisting of five linked nucleosides; (ii) a 3 'flanking segment consisting of five linked nucleosides, where the gap segment is positioned immediately adjacent to, and between the 5' flanking segment and the 3 'flanking segment, and where each nucleoside of each segment flanking comprises a 2'-O-methoxyethyl sugar; and where each internucleoside bond is a thiophosphate bond.
In certain embodiments, the modified compound oligonucleotide comprises: (i) a gap segment consisting of ten linked deoxynucleosides; . (ii) a 5 'flanking segment consisting of five nucleosides. 15 deosligados, | (iii) a 3 'flanking segment consisting of five linked nucleosides, where the gap segment is positioned immediately adjacent to, and between the 5' flanking segment and the 3 'flanking segment, where each nucleoside of each flanking segment comprises a 2-O-methoxyethyl sugar, and where each internucleoside bond is a thiophosphate bond, and where the nucleobase sequence comprises at least 8 nucleobases contiguous to the nucleobase sequence reported in SEQ ID NO: 80. In certain embodiments , the modified compound oligonucleotide comprises: (]) an interval segment consisting of ten linked deoxynucleosides; (ii) a 5 'flanking segment consisting of five linked nucleosides; (iii) a flanking segment 3 'consisting of five linked nucleosides - where the gap segment is positioned immediately adjacent to, and between the flanking segment 5' and the flanking segment 3 ', where each nucleoside of each segment f lanqueante comprises a sugar
2'-O-methoxyethyl; and where each internucleoside bond is a thiophosphate bond; and where the nucleobase sequence is reported in SEQ ID NO: 80. Certain embodiments provide a composition that comprises a compound as described herein, or a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides and containing a sequence of nucleobases comprising at least 12 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25 , 80, 86.87, 115, 120, 122, and 124 or a salt thereof and a pharmaceutically acceptable carrier or diluent.
Certain embodiments provide a composition that comprises a compound as described herein, or a salt thereof, and a carrier - pharmaceutically acceptable or a diluent. In certain embodiments, a. The composition comprises a modified oligonucleotide that consists of 12 to 30 nucleosides and has a nucleobase sequence that comprises at least 12 contiguous nucleobases from the nucleobase sequence reported in SEQ ID NO: 80 or a salt thereof and a pharmaceutically acceptable carrier. solvent or a thinner.
Certain modalities provide a composition that comprises a compound as described here, where the viscosity level is less than 40 cP. In certain embodiments, the composition has a viscosity level of less than 15 cP. In certain embodiments, the composition has a viscosity level of less than 12 cP. In certain embodiments, the composition has a viscosity level of less than 10 cP.
Certain modalities provide methods of treatment, prevention, or amelioration of transthyretin amyloidosis.
Certain embodiments provide methods that comprise administering to a animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to a animal a modified oligonucleotide consisting of 12 to 30 linked nucleosides and containing a sequence of nucleobases comprising
addresses at least 8 contiguous nucleobases of a sequence selected from the nucleobase sequences reported in SEQ ID NOs: 25, 80, 86, 87, 115, 120, 122 and 124. Certain modalities provide methods that comprise - administration to an animal of a compound as described here to an animal.
In certain embodiments, the method comprises administering to a animal a compound or a modified oligonucleotide consisting of 12 to 30 linked nucleosides, where the linked nucleosides comprise at least part of an 8 contiguous nucleobases complementary to part of equal length within the selected region of nucleotides 501-535 or 580-608 of SEQ ID NO: 1. Certain modalities provide methods that comprise administering to a animal a compound as described herein to an - animal.
In certain embodiments, the method comprises administering to a animal an modified oligonucleotide consisting of 12 to 30 linked nucleosides and has a nucleobase sequence comprising: at least 8 contiguous nucleobases of a reported nucleobase sequence in SEQ ID NO: 80. Certain embodiments provide methods that comprise administering an animal a compound as described herein to an animal.
In certain embodiments, the method comprises administering to a animal a compound or a modified oligonucleotide consisting of 12 to 30 linked nucleosides, where the linked nucleosides comprise at least part of an 8 contiguous nucleobases complementary to part of equal length within the selected region of nucleotides 508-527 of SEQ ID NO: 1. In certain embodiments, the animal is a human being.
In certain embodiments, administration prevents, treats, improves, or slows down the progression of transthyretin amyloidosis as described here. In certain embodiments, the compound is co-administered with a second agent.
In certain embodiments, the compound and the second agent are administered concomitantly.
In certain modalities, administration is parent administration.
In certain embodiments, parenteral administration is subcutaneous administration.
In certain embodiments, the formulation for administration is the compound in saline.
In certain embodiments, the compound comprises a modified oligonucleotide that consists of 12 to 30 linked nucleosides and has a nucleobase sequence that comprises at least 12 contiguous nucleobases from a nucleobase sequence selected from among the nucleobase sequences reported in SEQ ID NOs: 25 , 80, 86, 87, 115, 120, 122, and 124 or a salt thereof and saline.
In certain embodiments, the formulation does not include any stabilizing agent or additional stabilizing agent including lipid agents. , In certain modalities, the administration is parent administration. 15 teral In certain embodiments, parenteral administration is intracranial administration.
In certain modalities, intracranial administration is intracerebral, intrathecal, intraventricular, ventricular, intracerebrovascular, intraventicular, cerebral or ventricular traction.
Certain modalities even provide a method for reducing - transthyretin mRNA or protein expression in an animal that includes administering to the animal a compound or composition as described here to reduce transthyretin MRNA or protein expression in the animal.
In certain modalities, the animal is a human being.
In certain modalities, reducing transthyretin mRNA or protein expression prevents, treats, improves or delays the progression of transthyretin amyloidosis.
Certain embodiments provide a method for treating a human with a transthyretin-related disease comprising identifying the man with the disease and administering to the human being an amount of a therapeutically effective compound or composition - as described herein.
In certain modalities, treatment reduces a symptom selected from the group consisting of agitation, lack of coordination, nystagmus, spastic paraparesis, lack of muscle coordination, visual impairment, insomnia, unusual sensations, myoclonus, blindness, loss of speech, symptoms carpal tunnel syndrome, attacks, subarachnoid hemorrhages, stroke and hemorrhage in the brain, hydrocephalus, ataxia and spastic paralysis, coma, sensory neuropathy, paraesthesia, hypesthesia, motor neuropathy, autonomic neuropathy, orthostatic hypotension, cyclical constipation, cyclical diarrhea, nausea, vomiting, reduced sweating, impotence, delayed gastric emptying, urinary retention, urinary incontinence, progressive heart disease, fatigue, difficulty breathing, weight loss, lack of appetite, numbness, tingling, weakness, macroglossia, nephrotic syndrome, failure congestive heart failure, exertional dyspnea, peripheral edema, arrhythmias, palpitations, dizziness, syncope, postural hypotension, peripheral nerve problems, motor sensory deficiency, lower limb neuropathy, upper limb neuropathy, hyperalgesia, temperature sensation: altered, lower extremity weakness, cachexia, peripheral edema, hepa-. 15 tomegaly, purpura, diastolic dysfunction, premature ventricular contractions, cranial neuropathy, reduced reflexes of the deep tendon, deposits of amyloid in the vitreous body, vitreous opacity, dry eyes, glaucoma, curved appearance in the pupils, swelling of the feet due to water retention.
In certain modalities, the symptom is a cognitive symptom selected from the group consisting of impaired memory, impaired judgment and thought, impaired planning, impaired flexibility, impaired abstract thinking, impaired rule acquisition, impaired initiation of appropriate actions, inhibition improper actions compromised, impaired short-term memory, impaired long-term memory, para-noon, disorientation, confusion, hallucination and dementia.
In certain modalities, the symptom is a psychiatric symptom selected from the group consisting of dementia, anxiety, depression, blunted affection, egocentrism, aggressiveness, compulsive behavior, irritability, personality changes, including impaired memory, judgment and thinking and idealizing
suicidal action.
Other modalities provide a method of treating a human with transthyretin amyloidosis leading to cardiac and addiction amyloidosis.
administering to the human being a therapeutically effective amount of a compound or composition as described herein. In certain modalities, treatment reduces a symptom selected from the group consisting of congestive congestive heart failure, cardiomegaly, stress dyspnea, peripheral edema, arrhythmias, palpitations, dizziness, syncope, deposition in the subendothelium of peripheral vascularization can lead to severe postural hypotension, diastolic dysfunction, heart block, premature ventricular contractions and various tachyarrhythmias.
Other modalities provide a method of treating a human with transthyretin amyloidosis leading to peripheral neuropathic disorders and administering to the human being a therapeutically effective amount of a compound or composition as described herein. In certain modalities, treatment reduces a symptom selected from the group. consisting of peripheral nerve problems, sensory- .— 15 motor impairment, lower limb neuropathy, upper limb neuropathy, hyper-: pain, altered temperature sensation, weakness in the lower extremity, pain, autonomic dysfunction, which many it sometimes manifests as sexual or urinary dysfunction, symmetrical sensory weakness and weakness, orthostatic hypotension, diarrhea and / or impotence.
Other modalities provide a method of treating a human with transthyretin amyloidosis leading to gastrointestinal disorders and administering to the human being a therapeutically effective amount of a compound or composition as described herein. In certain modalities, treatment reduces a symptom selected from the constituted group - diarrhea, constipation, nausea, vomiting and disorders related to the kidney and liver.
There is also provided a method for reducing or preventing transthyretin amyloidosis, comprising administering to a human being a therapeutically effective amount of a compound or composition - as described herein, thereby reducing or preventing transthyretin amyloidosis.
A method is also provided to reduce or prevent a
cardiac disease, including administering a therapeutically effective amount to a human or composition as described herein, thereby reducing or preventing heart disease. There is still provided a method for reducing or preventing neuropathic disease, comprising administering to a human being a therapeutically effective amount of a compound or composition as described herein, thereby reducing or preventing a neuropathic disease. A method for reducing or preventing gastrointestinal disease is further provided, comprising administering to a human being a therapeutically effective amount of a compound or composition as described herein, thereby reducing or preventing a gastrointestinal disease.
There is also provided a method for ameliorating a symptom of transthyretin amyloidosis, comprising administration to a human being. in need thereof, a compound containing an oligonucleotide. 15 modified consisting of 12 to 30 linked nucleosides, where said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or f 4, thereby improving a symptom of transthyretin amyloidosis in humans.
A method is also provided to reduce the rate of progression of a symptom associated with transthyretin amyloidosis, comprising administering to a human in need of it, a compound containing a modified oligonucleotide consisting of 12 to 30 linked nucleosides, where the said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 4, thereby reducing the rate of progression - they are a symptom of transthyretin amyloidosis in humans.
A method is also provided to reverse the degeneration indicated by a symptom associated with transthyretin amyloidosis, comprising administering to a human being in need of it, a compound containing a modified oligonucleotide consisting of 12 to 30 — linked nucleosides , where said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 4, thereby reversing the degeneration indicated by a symptom of transthyretin amyloidosis in humans.
There is also provided a method for ameliorating a symptom of transthyretin amyloidosis, comprising administering to a human being in need thereof, a compound containing a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a sequence of nucleobases reported in SEQ ID NO: 80, thereby improving a symptom of transthyretin amyloidosis in humans.
Other modalities provide a method for treating a human with transthyretin amyloidosis, administering to a human being in need of it, a compound containing a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a sequence of nucleobases comprising at least 8 contiguous nucleobases of a "nucleobase sequence reported in SEQ ID NO: 80, thereby treating. 15 aamyloidosetranstirretin in humans.
In certain modalities, the symptom is a physical, cognitive, psychiatric, or peripheral symptom. In certain modalities, the symptom is a physical symptom selected from the group consisting of agitation, lack of coordination, nystagmus, spastic paraparesis, lack of muscle coordination, visual impairment, insomnia, unusual sensations, myoclonus, blindness, loss speech, carpal tunnel syndrome, attacks, subarachnoid hemorrhages, stroke and hemorrhage in the brain, hydrocephalus, ataxia and spastic paralysis, coma, sensory neuropathy, paraesthesia, hypesthesia, motor neuropathy, autonomic neuropathy, orthostatic hypotension, cyclic constipation, cyclic diarrhea, nausea, vomiting, reduced sweating, impotence, delayed gastric emptying, urinary retention, urinary incontinence, progressive heart disease, fatigue, difficulty breathing, weight loss, lack of appetite, numbness, tingling, weakness , macroglossia, nephrotic syndrome, congestive heart failure, dyspnea on exertion, peripheral edema, arrhythmias, palpitations, dizziness, syn cope, postural hypotension, peripheral nerve problems, motor sensory deficiency, lower limb neuropathy, upper limb neuropathy, hyperalgesia, altered temperature sensation, lower extremity weakness, cachexia, peripheral edema, hematomegaly, purple, diastolic dysfunction, premature ventricular contractions, cranial neuropathy, reduced reflexes of the deep tendon, amyloid deposits in the vitreous body, vitreous opacity, dry eyes, glaucoma, curved appearance in the pupils, swelling of the feet due to water retention.
In certain modalities, the symptom is a cognitive symptom selected from the group consisting of impaired memory, impaired judgment and thinking, impaired planning, impaired flexibility, impaired abstract thinking, impaired rule acquisition, initiation of actions compromised, inhibited improper actions, impaired short-term memory, impaired long-term memory, paranoia, disorientation, confusion, hallucination and dementia. In certain modalities, the symptom is a psychiatric symptom selected from the group consisting of dementia, anxiety, depression, dull affect. 15 do, egocentrism, aggressiveness, compulsive behavior, irritability,! personality changes, including damaged memory, judgment and: suicidal thinking and idealization.
In certain embodiments, the symptom is at least one of at least one physical symptom, at least one cognitive symptom and at least one psychiatric symptom, and at least one peripheral symptom.
In certain modalities, the physical symptom is selected from the group consisting of agitation, lack of coordination, movements involuntarily initiated, movements involuntarily not completed, unsteady gait, chorea, stiffness, contorted movements, abnormal posture, instability, abnormal facial expressions , difficulty in chewing, difficulty in swallowing, difficulty in speech, attack and sleep disturbances.
In certain modalities, the cognitive symptom is selected from the group consisting of impaired memory, impaired judgment and thought, impaired planning, impaired flexibility, impaired abstract thinking, impaired rule acquisition, impaired initiation of appropriate actions, inhibition of inappropriate actions compromised, damaged short-term memory, damaged long-term memory
each, paranoia, disorientation, confusion, hallucination and dementia.
In certain modalities, the psychiatric symptom is selected from the group consisting of dementia, anxiety, depression, blunted affection, egocentrism, aggressiveness, compulsive behavior, irritability, personality changes, including impaired memory, judgment and thinking and suicidal idealization.
In certain modalities, the peripheral symptom is selected from the group consisting of reduced brain mass, muscle atrophy, heart failure, impaired glucose tolerance, weight loss, osteoporosis, and atrophiatesticular.
Methods and compounds are also provided for the preparation of a medicament for the treatment, prevention, or amelioration of a disease related to the central nervous system.
fr Certain modalities provide for the use of a compound according to SS 15 described here in the manufacture of a medication to treat, improve, or prevent transthyretin amyloidosis.
Certain embodiments provide a compound as described here for use in the treatment, prevention, or amelioration of transthyretin amyloidosis as described here by combining therapy with a person or additional therapy as described here. The agents or therapies can be co-administered or administered concomitantly.
Certain embodiments provide for the use of a compound as described here in the manufacture of a medicament to treat, prevent, or improve transthyretin amyloidosis as described here by combining therapy with an agent or additional therapy as described here. Agents or therapies can be co-administered or administered concurrently.
Certain embodiments provide for the use of a compound as described here in the manufacture of a medicament to treat, prevent, or improve transthyretin amyloidosis as described here in a patient who is subsequently administered an additional agent or therapy as described here.
Certain modalities provide a Kit to treat, prevent, or improve transthyretin amyloidosis as described here where the kit comprises: (i) a compound as described here; and as an alternative (ii) an additional agent or therapy as described herein.
A Kit as described here may also include instructions for using the kit to treat, prevent, or improve transthyretin amyloidosis as described here by combination therapy, as described here.
Antisense compounds Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogues, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRrr NAs. An oligomeric compound can be "antisense" to a nucleic acid. 15 target, meaning you are able to hybridize with an acid! target nucleic acid through hydrogen bonding.
Y In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5 'to 3' directions, comprises the inverse complement of the target segment of a target nucleic acid to which it is directed. In some of these embodiments, an antisense oligonucleotide has a sequence of nucleobases that, when written in the 5 'to 3' direction, comprise the inverse complement of the target segment of a target nucleic acid for which it is marked.
In certain embodiments, an antisense compound labeled for a transthyretin nucleic acid is 12 to 30 nucleotides in length. That is, the antisense compounds are 12 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligo-nucleotide containing from 8 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 18 to 21, 19 to 22 or 20 linked nucleobases. In some of these modes, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22,23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
| 61/232 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68 , 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 linked nucleobases in length, or from a range defined by any two of the above values.
Ss In certain embodiments, the antisense compound comprises a reduced or truncated modified oligonucleotide. The modified or truncated modified oligonucleotide can have a single nucleoside deleted at the 5 'end (5' truncation), or alternatively at the 3 'end (3' truncation). A reduced or truncated oligonucleotide can have two - nucleosides deleted at the 5 'end or alternatively it can have two subunits deleted at the 3' end. Alternatively, the deleted nucleosides may be dispersed throughout the modified oligonucleotide, for example, in an antisense compound that has a num. cleoside deleted at the 5 'end and a nucleoside deleted at ex-22215 »end 3.
When a single additional nucleoside is present in an o-. elongated ligonucleotide, the additional nucleoside may be located at the 5 'or 3' end of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide that has two nucleosides added at the 5 'end (addition 5'), or alternatively at the end 3 '(addition 3'), of the oligonucleotide. Alternatively, the added nucleosides may be dispersed throughout the modified oligonucleotide, for example, in an oligonucleotide having a nucleoside - added at the 5 'end and a subunit added at the 3' end.
It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or to introduce unpaired bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89: 7305 - 7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in a oocyte injection model. Antisense oligonucleotides of 25 nucleobases in length with 8 or 11 unpaired bases near the ends of the antisense oligonucleotides were able to target specific cleavage of the target mR-NA, although to a lesser extent than the antisense olignucleotides which contained no lack of pairing. Likewise, specific target cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 unpaired.
Gautschi et al (J. Natl. Cancer Inst. 93: 463-471, March 2001) demonstrated the capacity of an oligonucleotide with 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bclxL MRNA, of reduced expression of bcl-2 and bel-xL in vitro and in vivo. In addition, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
Maher and Dolnick (Nuc. Acid. Res. 16: 3341 - 3358.1988) tested. a series of antisense oligonucleotides with 14 tandem nucleobases, e.g. 15 antisense unsoligonucleotides of 28 and 42 nucleobases composed of the sequence of two or three antisense oligonucleotides in tandem, respectively, regarding their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone could inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
Reasons for antisense compound In certain embodiments, antisense compounds labeled for a transthyretin nucleic acid have chemically modified subunits arranged in patterns, or motifs, to give antisense compounds properties such as improving inhibitory activity, increasing the affinity of binding to a target nucleic acid, or resistance to degradation by nucleases in vivo.
Antisense chimeric compounds usually contain at least one region modified to provide greater resistance to nuclease degradation, an increase in cellular absorption, an increase in binding affinity to the target nucleic acid, and / or an increase in inhibitory activity.
A second region of an antisense chimeric compound can optionally serve as a substrate for RNAse H cell endonuclease,
that cleaves the RNA strand from a double RNA: DNA.
Antisense compounds that have a gapmer motif are considered to be antisense chimeric compounds.
In a gapmer an internal region that has a plurality of linked nucleotides or nucleosides that support RNAseH cleavage is positioned between the outer regions that have a plurality of linked nucleotides or nucleosides that are chemically distinct from the linked nucleotides or nucleosides of the internal region.
In the case of an antisense oligonucleotide that has a gapmer motif, the gap segment generally serves as a substrate for the cleavage of endonucleases, while the flanking segments comprise modified nucleosides.
In certain modalities, the gap- regions. mer are differentiated by the types of sugar portions that make up each. 15 distinct region.
The types of sugar moieties that are used to differentiate regions of a gapmer may in some embodiments include BD-S ribonucleosides, BD-deoxyribonucleosides, 2'-modified nucleosides (said 2'-modified nucleosides may include 2-MOE and 2-0-CH ;, among others), and modified bicyclic sugar nucleosides (said modified bicyclic sugar nucleosides can include those that have a 4 "(CH2) nO-2 'bridge, where n = 1 or n = 2) Preferably, each distinct region includes portions of uniform sugars.
The flanking-gap-flanking motif is often described as "X-Y-Z", where "X" represents the length of the 5 'flanking region, "Y" represents the length of the interval region and "Z" represents the length of the 3' flanking region. As used here, a gapmer described as "X-Y-Z" has a configuration such that the gap segment is positioned immediately adjacent to each 5 'flanking segment and 3' flanking segment. Thus, no intermediate nucleotide exists between the 5 'flanking segment and the interval segment, or the gap segment and the 3' flanking segment. Any of the antisense compounds described herein can have a gapmer motif.
In some modalities, X and Z are the same, in other modalities they are different
tees. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 , 30 or more nucleotides. Thus, gapmers include, among others, for example, 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2- 16-2,1-18-1,3-10-3,2-10-2, 1-10-1, 2-8-2, 6-8-6 or 5-8-5.
In certain embodiments, the antisense compound as a "wingmer" motif, having a flanking -gap or gap-flanking configuration, ie an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, gapmer configurations include, among others, for example, 5-10, 8-4, 4-12, 124, 3-14,16-2, 18-1, 10-3, 2-10, 1-10 , 8-2, 2-13 or 5-13.
In certain embodiments, antisense compounds labeled for a transthyretin nucleic acid have a 5-10-5 gapmer motif.
] In certain embodiments, the antisense compounds labeled pa-. 15 a transthyretin nucleic acid has a 6-8-6 gapmer motif.
: In certain embodiments, antisense compounds labeled for a transthyretin nucleic acid have a 5-8-5 gapmer motif.
In certain embodiments, an antisense compound labeled for a transthyretin nucleic acid has an extended interval motif.
In certain embodiments, an interleaved antisense oligonucleotide labeled for a transthyretin nucleic acid has a ten-segment segment of 2'-deoxyribonucleotides positioned immediately next to, and between, flanking segment of five chemically modified nucleosides. In certain embodiments, the chemical modification comprises - includes a modification of 2 'sugar. In another embodiment, the chemical modification comprises a modification of the 2-MOE sugar.
In certain embodiments, an interleaved antisense oligonucleotide directed to a transthyretin nucleic acid has a segment of eight 2- deoxyribonucleotides positioned immediately next to, and between, flanking segment of five chemically modified nucleosides. In certain embodiments, the chemical modification includes a modification of the 2 'sugar. In another embodiment, the chemical modification comprises a modification of the 2-MOE sugar.
In certain embodiments, an interleaved antisense oligonucleotide directed to a transthyretin nucleic acid has a segment of eight 2- deoxyribonucleotides positioned immediately next to, and between, flanking segment of six chemically modified nucleosides. In certain embodiments, the chemical modification includes a modification of the 2 'sugar. In another embodiment, the chemical modification comprises a modification of the 2-MOE sugar.
Target nucleic acids, target regions and nucleotide sequences In certain embodiments, transthyretin nucleic acid is any of the sequences shown in the accession number in GEN-BANK NM 000371.2, first deposited in GENBANKO on 13th. February 2008 (incorporated here as SEQ ID NO: 1), no. access no .- 15 GENBANK NT 010966.10 truncated from nucleotides 2009236 to 1 2017289, first deposited in GENBANKO on August 1, 2002 (incorporated here as SEQ ID NO: 2); exons 1-4 extracted from the genome sequence of the rhesus monkey of no. access to GENBANK NW 001105671.1, based on similarity to human exons; and no. of access to GENBANK NW 001105671.1 truncated from nucleotides 628000 to 638000 (incorporated here as SEQ ID NO: 4), first deposited in GENBANKO on March 28, 2006.
It is understood that the sequence shown in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside bond, or a nucleobase.
As such, antisense compounds defined by a SEQ ID NO may independently comprise one or more modifications to a sugar moiety, an internucleoside bond or a nucleobase. The antisense compounds described by the ISIS number (ISIS No) or ISIS NO indicate a combination of nucleobase sequence and motif.
In certain embodiments, a target region is a structurally defined region of target nucleic acid. For example, a target region can encompass a 3 'UTR, a 5' UTR, an exon, an intron, an exon junction, a coding region, a translation start region, a translation end region, or another region nucleic acid. The structurally defined regions for transthyretin can be obtained by accessing sequence databases such as NCBI and such information is incorporated here for reference. In certain embodiments, a target region can span the sequence from a 5 'target site from a target segment within the target region to a 3' target site from another target segment within the target region.
The labeling includes determining at least one target segment for which an antisense compound hybridizes in such a way that the desired effect occurs. In certain embodiments, the desired effect is a reduction in the nucleic acid levels of the target MRNA. In certain modalities. the desired effect is to reduce the levels of the protein encoded by. 15 target nucleic acid or a phenotypic change associated with the target nucleic acid.
õ A target region can contain one or more target segments. Several target segments within a target region can overlap. Alternatively, they may not be overlapping. In certain embodiments, the target segments within a target region are separated by no more than approximately 300 nucleotides. In certain embodiments, the target segments within a target region are separated by a number of nucleotides which is, approximately, no more than, no more than approximately, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 nucleotides — deos in the target nucleic acid, or is in a range defined by two of the previous values. In certain embodiments, the target segments within a target region are separated by no more than, or no more than, approximately 5 nucleotides in the target nucleic acid. In certain modalities, the target segments are contiguous. Target regions defined by a strip that has an initial nucleic acid that is in any of the 5 'target sites or 3' target sites listed here are contemplated.
Appropriate target segments can be found within a 5 'RTU, a coding region, a 3' RTU, an intron, an exon or an exon / intron junction.
Target segments containing a start codon or a stop codon are also suitable target segments.
An appropriate target segment can specifically exclude a particular region structurally defined as the start codon or end codon.
Determination of the appropriate target segments may include a comparison of the target nucleic acid sequence with other sequences throughout the genome.
For example, the BLAST algorithm can be used to identify regions of similarity between different nucleic acids.
This comparison can prevent the selection of sequences of antisense compounds that can hybridize non-specifically to sequences other than those of the selected target nucleic acid (ie, non-target or off-target sequence). - There may be variation in activity (for example, as defined by the percentage reduction in target nucleic acid levels) of antisense compounds within an active target region.
In certain embodiments, reductions in transthyretin MRNA levels are indicative of inhibition of transthyretin expression.
Reductions in levels of a transthyretin protein are also indicative of inhibition of target MRNA expression. Furthermore, phenotypic changes are indicative of inhibition of transthyretin expression.
For example, increasing brain size to normal, improving motor coordination, decreasing continuous muscle spasms (dystonia), decreasing irritability and / or anxiety, improving memory, or increasing energy, among other changes phenotypes that can be analyzed.
Other phenotypic indications, for example, symptoms associated with transthyretin amyloidosis, can also be assessed as described below.
Hybridization In some embodiments, hybridization occurs between an antisense compound disclosed here and a transthyretin nucleic acid.
The most common hybridization mechanism involves hydrogen bonds (for example, Watson-Crick, Hoogsteen hydrogen bonds or Ho-
ogsteen) between complementary nucleobases of nucleic acid molecules. Hybridization can occur under varying conditions. Strict conditions are sequence dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
Methods for determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided here are specifically hybridizable to a transthyretin nucleic acid. Complementarity An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases from the antisense compound can hydrogen bond to the corresponding nucleobase of the target nucleic acid, so that it will occur a desired effect (for example, antisense inhibition of a target nucleic acid, .15 as a transthyretin nucleic acid).
: An antisense compound can hybridize to one or more 'segments of a transthyretin nucleic acid so that adjacent or intermediate segments are not involved in the hybridization event (for example, a loop structure, unmatched or hook structure) .
In certain embodiments, the antisense compounds provided herein, or a specified part thereof, are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a transthyretin nucleic acid, a target region, or a specific segment of it. The percentage of complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
For example, an antisense compound in which 18 out of 20 nucleotides of the antisense compound are complementary to a target region and therefore hybridize specifically, would represent a 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be grouped or interleaved with complementary nucleobases and do not need to be contiguous to each other or to complementary nucleobases. As such, an antisense compound that has 18 nucleobases in length with 4 (four) non-complementary nucleobases which are flanked by two regions completely complementary to the target nucleic acid would have 77.8% total complementarity with the acid target nucleic acid and would therefore fall within the scope of the present invention. The percentage of complementarity of an antisense compound with a target nucleic acid region can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). The percentages of homology, sequence identity or complementarity can be determined using, for example, the Gap program (Wisconsin sequence analysis package, Version 8 for Unix, Genetics Compu- * 15 ter Group, University Research Park, Madison Wis.), Using standard configurations, which use the Smith and Waterman algorithm (Adv. Appl. Ma-. Th., 1981, 2, 482 489).
In certain embodiments, the antisense compounds provided herein, or specific portions thereof, are entirely complementary (i.e., 100% complementary) to a target nucleic acid, or specific portion thereof. For example, the antisense compound can be fully complementary to a transthyretin nucleic acid, or to a target region, or to a target segment or target sequence thereof. As used here, "completely complementary" means that each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is entirely complementary to a target sequence that is 400 nucleobases in length, provided that there is a corresponding 20 nucleobase portion of the target nucleic acid that is entirely complementary to the antisense compound. Completely complementary it can also be used in reference to a specific part of the first and / or the second nucleic acid. For example, a 20 nucleobase portion of a compound of a 30 nucleobase antisense compound can be "completely complementary" to a target sequence that is 400 nucleobases in length. The 20 nucleobase part of the 30 nucleobase oligonucleotide is completely complementary to an alveolar sequence, the target sequence has the corresponding 20 nucleobase part where each nucleobase is complementary to the 20 nucleobase part of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be completely complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
The position of a non-complementary nucleobase can be at the 5 'or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be in. an internal position of the antisense compound. When two or more nucleo-. 15 non-complementary bases are present, they can be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary base f is located in the flanking segment of a gapmer antisense oligonucleotide.
In certain embodiments, antisense compounds that are, or are up to 12,13, 14,15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or not more than 1 non-complementary nucleobase (s) referring to a target nucleic acid, such as a transthyretin nucleic acid, or a specific part of it.
In certain embodiments, antisense compounds that have, or have, 12,13,14,15,16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases of length comprise not more than 6, not more than 5, not more than 4, not more than 3, not more than 2, or not more than 1 non-complementary nucleobase (s) referring to a target nucleic acid, such as a transthyretin nucleic acid, or a specific part of it.
The antisense compounds provided here also include those that are complementary to a part of a target nucleic acid. As used here, "part" refers to a defined number of nucleotides
contiguous (i.e., linked) cells within a region or segment of a target nucleic acid.
A "part" can refer to a defined number of contiguous nucleobases of an antisense compound.
In certain embodiments, the antisense compounds are complementary to at least a part of 8 —nucleobases of a target segment.
In certain embodiments, the antisense compounds are complementary to at least a portion of 12 nucleobases from a target segment.
In certain embodiments, the antisense compounds are complementary to at least a part of 15 nucleobases from a target segment.
Also contemplated are antisense compounds that are complementary to at least part of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobases of a target segment, or a defined range for two of those values.
Identity - The antisense compounds provided here may also have a: 15 percent defined identity for a particular nucleotide sequence, SEQ ID NO, or compound, represented by a specific Isis number, or a part thereof.
As used here, an antisense compound is identical to the sequence disclosed here if it has the same nucleobase matching capability.
For example, an RNA that contained the urailanolanol thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence as long as uracil and thymidine match adenine.
Shortened and elongated versions of the antisense compounds described here, as well as compounds containing bases not identical to the antisense compounds provided here are also contemplated.
Non-identical bases can be adjacent to each other or dispersed throughout the antisense compound.
The percentage of identity of an antisense compound is calculated according to the number of bases that have identical base matching in relation to the sequence being compared.
In certain embodiments, the antisense compounds, or parts of them, are at least 70%, 75%, 80%, 85% 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs,
or a part of them, disclosed here. Modifications A nucleoside is a combination of sugar-base. The nucleoside (also known as base) part of the nucleoside is usually a heterocyclic base portion. Nucleotides are nucleosides that also include a phosphate group covalently linked to the sugar part of the nucleoside. For nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2 ', 3' or 5 'hydroxyl group of the sugar. Nucleotides are formed by covalently bonding adjacent nucleosides together to form a linear polymeric oligonucleotide. Within the structure of the oligonucileotide, phosphate groups are commonly referred to as forming the internucleoside bonds of the oligonucleotide.
Modifications to antisense compounds include substitutions or changes in internucleoside bonds, parts of sugars or. 15 nucleobases. The modified antisense compounds are often preferred over native forms because of desirable properties, such as, for example, greater cell absorption, greater affinity for the target nucleic acid, greater stability in the presence of nucleases, or greater inhibitory activity .
Chemically modified nucleosides can also be used to increase the binding affinity of a shortened or truncated antisense oligonucleotide to its target nucleic acid. Consequently, comparable results can often be obtained with shortened antisense compounds that have said chemically modified nucleosides.
Modified internucleoside bonds The naturally occurring internucleoside bond between RNA and DNA is a 3 'to 5 phosphodiester bond. Antisense compounds containing one or more modified internucleoside bonds, ie, non-naturally occurring internucleoside bonds, are often selected on antisense compounds containing internocleoside bonds that occur naturally due to desirable properties,
as, for example, greater cellular absorption, greater affinity for the target nucleic acid and greater stability in the presence of nucleases. Oligonucleotides containing modified internucleoside bonds include internucleoside bonds that hold a phosphorus atom, as well as internucleoside bonds that do not have a phosphorus atom. Internucleoside bonds containing the representative phosphorus include, among others, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates and phosphorothioates. Methods of preparing phosphorus-containing and non-phosphorus-containing bonds are well known.
In certain embodiments, antisense compounds labeled for a transthyretin nucleic acid comprise one or more modified inter-nucleoside bonds. In certain embodiments, the modified internucleoside bonds are phosphoroticate bonds. In certain embodiments, each internucleoside bond of an antisense compound is an internosulfosphosphoroticate bond. : Portions of modified sugars. The antisense compounds of the invention can optionally contain one or more nucleosides where the sugar group has been modified. Said modified sugar nucleosides may confer greater —nuclease stability, greater binding affinity or some other beneficial biological property for antisense compounds. In certain embodiments, the nucleosides comprise chemically modified portions of the ribofuranosis ring. Examples of chemically modified ribofuranosis rings include, but are not limited to, adding substituent groups (including 5 'and 2 substituent groups) in bridging non-germ ring atoms to form bicyclic nucleic acids (BNA), replacing the ribosyl ring oxygen atom with S, N (R), or C (R1) (R2) (R, R; and R> are each independently H, C, - Cai2alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include nucleosides with substituted 2'-F-S-methyl (see International PCT Application WO 2008/101157 published 8/21/08 for other 5 ', 2, substituted nucleosides disclosed ) or replacement of the oxygen atom of the ribosyl ring with S with yet another substitution in the 2'- position (see US Patent Application 2005200-0130923, published on June 16, 2005) or alternatively a 5 'replacement of a BNA ( see international PCT application WO 2007/134181 published on 11/22/07 where ANL is replaced with for example a 5'-methyl or S-vinyl group) Examples of nucleosides containing modified sugar moieties include, but are not limited to, nucleosides comprising 5'-vinyl, 5'-methyl ((R or S), 4 "-S, 2-F, 2-OCHCH; 3, 2-OCHCHCH ;, 2 OCH; CH3F and 2'-0 substituent groups (CH2) 2OCH; 3. The substituent at the 2 'position can also be selected from allyl, amino, azido, thio, O-allyl, O-Cy-C10 alkyl, OCF3, OCH2F, O (CH2) -SCH3, O ( CH2) 2-ON (Rm) (Rn), O-CH27-C (= O) -N (Rm) (Rn), and O-CH2-C (= O) -N (R) - (CH2) 2-N (Rn) (Rn), where each Ri , Rm and Rn is independently substituted or unsubstituted H or C1-C1.5 alkyl.
. As used here, "bicyclic nucleosides" refers to nu-. 15 - modified cleosides comprising a portion of bicyclic sugar. Examples of bicyclic nucleosides include among other nucleosides that + comprise a bridge between the atoms of the 4 'and 2 ribosyl ring. In certain embodiments, the antisense compounds provided herein include one or more bicyclic nucleosides that comprise a 4' to 2 'bridge . Examples of said 4 'to 2' bridged bicyclic nucleosides include, among others, one of the formula: 4 '- (CH2) -O-2' (ANL); 4 '- (CH2) -S-2'; 4 '- (CH2), - 0-2' (ANE); 4- CH (CH3) -0-2 'and 4-CH (CH; OCH3) -0-2' (and analogues thereof, see U.S. Patent 7,399,845, issued July 15, 2008); 4-C (CH3) (CH; 3) -O-2 '(and analogues thereof, see International Order Publication —WO / 2009/006478, published on 8 January 2009); 4-CH2-N (OCH; 3) -2 '(and analogues thereof see international application publication WO / 2008/150729, published on 11 December 2008); 4-CH7-O- N (CH; 3) -2 '(see patent application US2004-0171570, published on September 2, 2004); 4'-CH2-N (R) -O-2 ', where R is H, C1-C12 alkyl or a protecting group (see U.S. Patent 7,427,672, issued September 23, 2008); 4-CH> -C (H) (CH3) -2 '(see Chattopadhyaya et al, J. Org. Chem, 2009, 74, 118-134); and 4-CH7-C (= CH>) - 2 '(and analogues of the same
international application notice WO 2008/154401, published on 8 December 2008). Still other reports related to bicyclic nucleosides can also be found in the published literature (see, for example: Singhetal, Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129 (26) 8362-8379; Elayadi et al, Curr. Opinion Invest. Drugs, 2001,2,558-561; Braasch et al, Chem. Biol., 2001, 8, 1-7; and Orum et al, Curr. Opinion Mol. Ther, 2001, 3, 239-243; US Patent Nos.
6,268,490; 6,525,191; 6,670,461; 6,770,748, 6,794,499; 7,034,133;
7,053,207; 7,399,845; 7,547,684; and 7,696,345; US Patent Publication - US2008-0039618; US2009-0012281; US patents 60 / 989,574; 61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; Orders: International PCT WO published 1994/014226; WO 2004/106356; WO. 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401; and WO 2009/006478. Each of the aforementioned bicyclic nucleosides can be prepared containing one or more stereochemical configurations of sugars including, for example, aL-ribofuranose and BD-ribofuranose (see international PCT application PCT / DK98 / 00393, published on March 25, 1999 as WO 99/14226). In certain embodiments, the bicyclic sugar portions of BNA nucleosides include, among others, compounds with at least one 4 'and 2' cross-linking bridge of the pentofuranosyl sugar moiety where such independent bridges comprise 1 or 2 to 4 linked groups independently selected from - [C (Ra) (Ru) lh-, -CIRa) = C (Rv) -, -C (Ra) = N-, -C (= 0) -, -C (= NR) -, -C (= S) -, -O-, -SI (Ra) 2-, -S (= O) r, € N (Ra) -; where: x is 0, 1.0u2; right 1,2,3o0u4; each R, and Rv is, independently, H, a protective group, hybrid
droxyl, C1-C12 alkyl, substituted Cy-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, Cs-C2o aryl, Cs-Ca, 6 substituted aryl, radical! heterocycle, substituted heterocycle radical, heteroaryl, substituted heteroaryl, Cs-C radical; alicyclic, C5-C7 radical —substituted alicyclic, halogen, OJ1, NJiJa, SJ1, Na, COOU ;, acyl (C (= O) -H), substituted acyl, CN, sulfonyl (S (= O) 2-J1) , or sulfonyl (S (= O) -J1); and each J, and J, is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, C2-C12 substituted alkenyl, C2-C12 alkynyl, C2-C12 substituted alkynyl, Cs-Ca9 aryl, Cs-C2, substituted aryl, acyl (C (= O) -H), substituted acyl, a heterocyclic radical, a substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a substituted group protector.
In certain embodiments, the bridge of a portion of bicyclic sugar is JC (R (Roy) lwr, [C (Ra) (Ro) lnO-, -C (R.Ro) -N (R) -O- or -C (RaRy) -ON (RY-.. 15 In certain embodiments, the bridge is 4-CH72-2 ', 4 :-( CH2) 2-2', 4- (CH2) 3-2 ', 4 -CH2-: 0-2, 4 '- (CH2) 2-0-2', 4-CH2-ON (R) -2 'and 4-CH> -N (R) -O0-2'- where each R is, independently, H, a protecting group or C, -C2 alkyl.
In certain embodiments, bicyclic nucleosides are still defined by the isomeric configuration.
For example, a nucleoside comprising a 4'-2 'methylene-oxy bridge, can be in the a-L configuration or in the B-D configuration.
Previously, a-L-methylene-oxy (4-CH7-O0-2 ') from BNAs were incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In certain embodiments, bicyclic nucleosides include, among others, (A) BNA aL-methylene-oxy (4'-CH2-0-2 "), (B) BNA BD-methylene-oxy (4 ' -CH2-0-2), the (C) ethylene-oxide BNA (4 '- (CH2), - O-2 "), the (D) amino-oxide BNA (4-CHz-ON (R) -2 '), the (E) oxyamine amino (4': - CH2-N (R) -O-2), and the (F) methyl (methylene-oxide) BNA (4-CH (CH3) -O0-2 " ), methylene (G) BNA (4'-CH2-S-2), methylene (H) BNA (4'-CH2-N (R) -2 '), methyl (1) BNA carboxylic (4-CH-CH (CH; 3) -2 '), and the (J) BNA propylene carboxylic (4' - (CH2) 3-2 ') as described below.
O, Bx t O.
Bx ot “OO - (A) 6) (O) E Bx E fr o Bx os Gives NT nel" TN RO SO R go OD) (E) E) im nb im o Bb ft o Bb im o Bb E nd ho X) ER CH; 3 as GS) fia O o where Bx is the base portion and R is independently H, a protecting group B or C1-C12 alkyl.5 In certain embodiments, bicyclic nucleosides are supplied containing the Formula |: Y TA qe 9 P e 1 where: Bx is a portion of heterocyclic base; -O3-Ov7-Q. Is -CH-N (Re) -CH7z-, -C (= O) -N (R ) -CH2-, -CH2-ON (Ro) -, -CHa-N (R) -O- or -N (R.) - O-CH> -; Re is C1-C12 alkyl or a protective amino group; and Ta E Tp are each, independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety or a covalent bond to a support medium.
In certain embodiments, bicyclic nucleosides are supplied containing Formula II:
To o. , Bx u where: Bx is a heterocyclic base portion; T, a and Ty are each, independently H, a protective hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety or a covalent bond to a support medium.
Za Is C1-Cg alkyl, C2-Cs alkenite, C2-Cg alkynite, C1-Cs substituted alkyl, C2-Cs alkenyl, C2-Cs alkyn! substituted, acyl, substituted acyl, substituted starch, substituted thiol or uncle.
In one embodiment, each of the substituted groups is, independently, mono- or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJe, NJeJa, SJe, Na,. OC (= X) J., And NJEC (EX) NJ.Ja, where each J., Ja EJe is, independently, H,: C1-C; alkyl, or C1-Cs substituted alkyl and X is O or NJ .. In certain embodiments, bicyclic nucleosides are supplied containing the Formula III: Tv o: SO. 4 9 mm Tt where: Bx is a heterocyclic base portion; T, and Ty are each, independently H, a protective hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety or a covalent bond to a support medium.
Z, is C1-C6 alkyl, C2-Cg alkenyl, C2-Cs alkynyl, substituted C1-Cs alkyl, substituted C2-Cs alkenyl, substituted C2-Cs alkynyl or substituted acyl (C (= O) -).
In certain embodiments, bicyclic nucleosides are supplied containing Formula IV: Te Bx
T q 4 W 5 OR; where: Bx is a heterocyclic base portion; Ta and Ty are each, independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety or a covalent bond to a support medium.
Ra is C1-Cs alkyl, C1-Cs substituted alkyl, C2-Cs alkenyl, C2-Cylkenyl substituted, C2-Cs alkynyl, or C2-C; s substituted alkynyl; each ds, do, of E qa Is, independently, H, halogen, C1-Cs alkyl, C1-C; s substituted alkyl, C2-Cs alkenyl, C2-C; substituted alkenyl, - C2-Cs alkynyl or C2-C; s substituted alkynyl, C1-Cs alkoxyl, C1-Cs alkoxyl. substituted, acyl, substituted acyl, C, -Cs aminoalkyl or substituted C1-Ck aminoalkyl; In certain embodiments, bicyclic nucleosides are supplied containing Formula V:
SO o-T, and 9 o v where: Bx is a heterocyclic base portion; Ta € Ty are each, independently H, a protective hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety or a covalent bond to a support medium.
da, dv, de E qr Are each, independently, hydrogen, halogen, C1-C2 alkyl, C1-C12 substituted alkyl, C2-C12 alkenyl, C2-C12 alkenyl, C2-C12 alkynyl, C2-C12 alkynyl substituted, C1-C12 alkoxy, C1-C12 substituted alkoxy, OJ ;, SJ, SOJ, SO2J ;, NJjJk, Na, CN, C (= O)
OJj, C (= EO) NJjdk, C (= O) J, OC (= O) NJjJk, N (H) C (ENH) NJjJ ,, N (H) C (= O) NJjJk or N (H) C (= S) NJjJk; Or q and E qr together are = C (qa) (qn); qa € qn are each, independently, H, halogen, C1-C12 alkylor Cy-Ci7 substituted alkyl.
The synthesis and preparation of BNA methylene-oxide monomers (4-CH27-0-2 ') adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, together with their oligomerizations, and the recognition properties of nucleic acid have been described (Koshkin et a., Tetrahedron, 1998, 54, 3607-3630). ANBs and their preparation are also described in WO 98/39352 and WO 99/14226. Analogs of methylene-oxide BNA (4-CH2-O0-2 ') and ANBs-2 "-io were also prepared (Kumar et al., Bioorg.
Med.
Chem.
Lett., 1998, 8, - 2219-2222). The preparation of blocked nucleoside analogs with- 15 comprising oligodeoxyribonucleotide duplex as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). In addition, the synthesis of BNA-2'-amino, a new high-affinity, restricted-conformation oligonucleotide analogue has been described in the art (Singh et al., J.
Org.
Chem., 1998, 63, 10035-10039). In addition, BNA-2 "- amino and BNA-2'-methylamino were prepared and the thermal stability of their duplexes with RNA strands and complementary DNA was previously reported.
In certain embodiments, bicyclic nucleosides are supplied containing Formula VI: TO O Bx 4% vI qe! where: Bx is a heterocyclic base portion; Ta and Tv are each, independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety or a covalent bond to a support medium.
each q ,, q; q and q are, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, C2-C12 substituted alkenyl, C2-C12 alkynyl, Ca-C12 substituted alkynyl, C1-C12 alkoxyl, C1 -C12 substituted alkoxylate, OJ ;, SJ, SOJ ,, SO2Jj, NJjJk, Na, CN, C (= 0) OJ, C (= O) NJjJk, CEO, OC (= O) NJjJ ,, N (H ) C (= NH) NJJ, N (H) C (= O) NJjJk or N (H) C (= S) NJjJk; and qi and q; or q, and q. together are o = C (dg) (dn), where q, and q are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.
A bicyclic carboxylic nucleoside containing a 4 ”- (CH2) 3-2 'bridge and the alkenyl analog bridge 4-CH = CH-CH7-2' have been described (Freier et al., Nucleic Acids Research, 1997, 25 (22 ), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of bicyclic carboxylic nucleosides, together with their oligomerizations and the: 15 biochemical studies have also been described (Srivastava et al, J. Am.: Chem. Soc., 2007, 129 (26), 8362 -8379).
e As used herein, "bicyclic nucleoside 4'-2" or "bicyclic nucleoside 4 'to 2" refers to a bicyclic nucleoside comprising a furanose ring which comprises a bridge connecting two carbon atoms in the furanose ring which connects the 2 'carbon atom and the 4' carbon atom of the sugar ring.
As used herein, "monocyclic nucleosides" refers to nucleosides that comprise portions of modified sugars that are not portions of bicyclic sugars. In certain embodiments, the sugar moiety, or the sugar moiety analog, of a nucleoside can be modified or replaced at any position.
As used herein, "2'-modified sugar" means a furanosyl sugar modified in the 2 'position. In certain embodiments, such modifications include the substituents selected from: a halide, including, among others, the substituted and unsubstituted alkoxy and the substituted and unsubstituted thioaquyl, the substituted and unsubstituted amino alkyl, the substituted alkyl. and unsubstituted, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2 'modifications are selected from the substituents including, among others: O [(CH2), OlmCHs, O (CH2) .NH2, O (CH2) JCHsa, O (CH2) JF, O (CH2) JONH2, OCHC (= O) N (H) CH ;, and O (CH2), ONI (CH2), CH3] 2, where neither are from 1 to approximately 10. Other 2 'substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, F, CF3, OCF3, SOCH; s3, SO2CHs, ONO, NO », N3, NH, hetrocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleavage group, a reporter group, an interleaver, a group to improve the pharmacokinetic properties, or a group to improve the pharmacodynamic properties of a compound antisense, et al substituents containing similar properties. In certain embodiments, the modified nucleosides comprise. a 2-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-715 12000). Said 2-MOE substitutions have been described as containing improved binding affinity when compared to the unmodified nucleosides and the other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides containing the 2'-MOE substituent have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann ef al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleoside Nucleotides, 1997, 16, 917-926).
As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside containing a six-membered tetrahydropyran "sugar" substituted on the pento-furanosyl residue in normal nucleosides (a sugar substitute). The modified THP nucleosides include, among others, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem. ., 2002, 10, 841-854), fluorofior HNA (F-HNA) or those compounds that have the formula VII:
4 q “and the E 7 4 6 Bx q Ri RS
VII wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII: Bx is a heterocyclic base portion; Ta and Ty are each, independently, an internucleoside-binding group that binds the nucleoside tetrahydropyrane analog to the antisense compound or one of the T's, and T, is an internucleoside-binding group that binds the tetra nucleoside analog -hydropyran to the antisense compound and the other to T, and T, is H, a hydroxyl protecting group, a linked conjugate group or a 5 'or 3' terminal group; er. 10 Qi, da, da, Ja, ds, ds E q7 Are each independently, H, C1- - Cs alkyl, C1-Cg6 substituted alkyl, C2-C6 alkenyl, C2-Cg alkenyl substituted, C2-Cs alkynyl or substituted C2-Cg alkynyl; and each of the R, and R2 is selected from hydrogen, hydroxyl, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, Na, OC (= X) Ja, OC (= EX) NJiJ2, NJI3C (= EX) NJ; J and CN, whereXéoO, S or NJ; and each J ,, Je J; are, independently, H or C1-Cg alkyl. In certain embodiments, the modified THP nucleosides of Formula VI! are provided where q, q2, 43, da, ds, ds € q7 Are each H. In certain modalities, at least one of q, dz, da, da, ds, of E q; it is another addition to H. In certain modalities, at least one of the q :, da, da, da, ds, ds E q; it's methyl. In certain embodiments, the THP nucleosides of Formula VII are provided where one of the R; and R> is fluorine. In certain embodiments, R; is fluorine and D H; R; is methoxy and Rz is H, and R; is H and R2 is methoxyethoxy. As used herein, "2'-modified" or "2'-substituted" refers to a nucleucleoside comprising a sugar comprising a substituent in the 2 'position that is other than H or OH. The modified 2'-nucleosides include, among others, the nucleosides where the bridge connects
the two carbon atoms in the sugar ring connect the 2 'carbon and another carbon in the sugar ring; and nucleosides with 2 'non-binding substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, -OCF3, O- (CH2) 2-O-CH3, 2-0 (CH2), SCH3, O- (CH72) 2-ON (Rm) (Rn), or O-CH2-C (= O) -N (RnX (Rn), ondecadaRrheR, is, independently, substituted H or C1-C15 alkyl or not substituted.
2'-modified nucleosides may further comprise other modifications, for example, in other positions of the sugar and / or in the nucleobase.
As used herein, "2-F" refers to a nucleoside that comprises a sugar that comprises a fluorine group at the 2 'position. As used herein, "2-OMe" or "2" -0CH; 3 "or" 2'-O-methyl "each refers to a nucleoside comprising a sugar consisting of an -OCH group; at the 2 'position of the sugar ring - As used here, "MOE" or "2-MOE" or "2-O0CH2CH , O- . 15 CH; or "2-O-methoxyethyl" each refers to a nucleoside that comprises: a sugar consisting of a -OCH; CH2OCH; 3 group at the 2 'position of the sugar ring.
As used herein, "oligonucleotide" refers to a compound that comprises a plurality of linked nucleosides.
In certain embodiments, one or more of the plurality of nucleosides are modified.
In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA). Many other bicycles and sugar substitute tricycle systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, for example, review article: Leumann, Bioorg.
Med.
Chem., 2002, 10, 841-854). Said ring systems can undergo several additional substitutions to improve the activity.
Methods for the preparation of modified sugars are well known to those skilled in the art.
In nucleotides containing modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate target nucleic acid.
In certain embodiments, the antisense compounds comprise one or more nucleosides containing modified sugar moieties. In certain modes, the modified sugar portion is 2-MOE. In certain modes, the modified 2'-MOE nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a bridge group (4-CH (CH3) -0-2). In certain embodiments, the modified (4-CH (CH3) -O-2 ') nucleosides are arranged through the flanks of a gapmer motif. Modified nucleobases Modifications or substitutions of nucleobases (or bases) are structurally interchangeable with, yet functionally interchangeable with, naturally occurring or unmodified synthetic nucleobases. Both natural and modified nucleotides are able to participate in hydrogen n bonds. Such modifications of nucleobases can confer stability. of nuclease, binding affinity or some other beneficial biological property for antisense compounds. The modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Some nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound to a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase the stability of double nucleic acids by 0.6-1.2ºC (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton 1993, pp. 276-278).
Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl among other alkyl adenine and guanine derivatives, 2-propyl and other alkyl derivatives of - adenine and guanine, 2-thiouracil, 2-thiotimine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl -C = C-CH; 3) uracil and cytosine among other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, B-trifluormethyl and other uracils and cytosines 5- substituted, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine e7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Parts of heterocyclic bases may also include those in which the purine or pyrimidine base is replaced by other heterocyclics, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and substituted N-2, N-6 and O-6 purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
In certain embodiments, antisense compounds labeled for - a transthyretin nucleic acid comprise one or more modified nucleobases. In certain embodiments, the "extended range antisense oligonucleotides labeled for a transthyretin nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine Compositions and methods for the formulation of pharmaceutical compositions The antisense oligonucleotides can be mixed with active or inert pharmaceutically acceptable substance for the preparation of pharmaceutical compositions or formulations The compositions and methods for the formulation of pharmaceutical compounds are dependent on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
The antisense compounds labeled for a transthyretin nucleic acid can be used in pharmaceutical compositions by combining the antisense compound with an appropriate pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate buffered saline (PBS). PBS is a diluent suitable for use in compositions to be administered parenterally. Accordingly, in one embodiment, the methods described herein employ a pharmaceutical composition comprising an antisense compound labeled for a transthyretin nucleic acid and a pharmaceutically acceptable diluent.
In certain embodiments, the pharmaceutically acceptable diluent is PBS.
In certain modalities, the antisense compound is an antisense oligonucleotide.
Pharmaceutical compositions comprising antisense compounds comprise any pharmaceutically acceptable salt, esters or salts of said esters, or any other oligonucleotide which, after administration to an animal, including a human, is capable of supplying (directly or indirectly) the biologically active metabolite or residue therefrom.
Therefore, for example, the disclosure is also designed for pharmaceutically acceptable salts of antisense compounds, prodrug, pharmaceutically acceptable salts of said prodrugs, among others bioequivalently. lenses.
Suitable pharmaceutically acceptable salts include, but are not limited to, .- 15 saltsodium and potassium. i A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound that are cleaved by endogenous nucleases within the body to form the active antisense compound.
Conjugated antisense compounds Antisense compounds can be covalently linked to one or more moieties or conjugates that improve the activity, cell distribution or cell absorption of the resulting antisense oligonucleotides.
Typical conjugated groups include portions of cholesterol and lipid portions.
Additional conjugated groups include carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluoresceins, rodamines, coumarins and dyes.
The antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both ends of the antisense compounds to improve properties such as, for example, stability for nucleases.
Included in the stabilizer groups are the cover structures.
These terminal modifications
They contain the antisense compound containing terminal nucleic acid from the degradation of exonucleases, and can assist in administration and / or localization within a cell.
The cap may be present at the 5 '(5-cap) terminal, or at the 3' (3-cap) terminal, or it may be present at both terminals.
The cover structures are well known in the art and include, for example, inverted deoxy basic covers.
Other 3 'and 5' stabilizing groups that can be used to terminate one or both ends of an antisense compound to confer nuclease stability include those disclosed in WO 03/004602 published on 16 January 2003. Cell culture and treatment antisense compounds The effects of antisense compounds on the level, activity or expression of transthyretin nucleic acids can be tested in vitro on a variety of cell types.
The cell types used for said analyzes are available from commercial suppliers (for example, Ame- '15 rican Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Trian-: gle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the supplier's instructions using commercially available reagents (for example.
Invitrogen Life Technologies, Carisbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, AS49 cells, GMO04281 fibroblasts and LLC-MK2 cells. In vitro analysis of antisense oligonucleotides Methods for treating cells with antisense oligonucleotides are described here, which can be modified appropriately for treatment with other antisense compounds.
In general, cells are treated with antisense oligonucleotides when the cells reach about 60-80% confluence in the culture.
A reagent commonly used to introduce antisense oligonucleotides into cell culture includes the cationic lipid transfection reagent LIPOFECTIN & (Invitrogen, Carlsbad, CA). The antisense oligonucleotides are mixed with LIPOFECTIN € in OPTI-MEM & 1 (Invitogen, Carlsbad, CA) to achieve the desired final oligonucleotide concentration.
antisense otide and a concentration of LIPOFECTIN & which generally ranges from 2 to 12 ug / mL per 100 nM of antisense oligonucleotide. Another reagent commonly used to introduce antisense oligonucleotides into cell culture includes LIPOFECTAMINE 20000 (Invogen, Carisbad, CA). The antisense oligonucleotides are mixed with LIPOFECTAMINE 20008 in OPTI-MEMO 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of the antisense oligonucleotide and a concentration of LIPOFECTAMINEO that generally ranges from 2 to 12 ug / ml per 100 nM antisense oligonucleotide .
Another reagent used to introduce antisense oligonucleotides into cell culture includes Cytofectin & (Invitrogen, Carlsbad, CA). The antisense oligonucleotide is mixed with Cytofectin & in OPTI-MEM & 1 with reduced serum medium (Invitrogen, Carlsbad, CA) to achieve cons. desired concentration of the antisense oligonucleotide and a concentration of. 15 - Cytofectinê that generally varies from 2 to 12 µg per 100 nM of antisense oligonu-: cleotide. r Another technique used to introduce antisense oligonucleotides into cell culture includes electroporation. The cells are treated with antisense oligonucleotides by routine methods. Cells are normally harvested 16-24 hours after treatment with antisense oligonucleotide, during which time levels of target RNA or nucleic acid protein are measured by methods known in the art and described here. In general, when treatments are carried out in several repetitions, data are presented as the average of treatments in replicates.
The concentrations of antisense oligonucleotides used vary from cell line to cell line. Methods for determining the optimal concentration of the antisense oligonucleotide for a particular cell line are well known in the art. Oligonucleotides — antisense are normally used in concentrations ranging from 1 nM to 300 nM when they are transfected with LIPOFECTAMINE2000 &, Lipofecin or Cytofectin. The antisense oligonucleotides are used in concentrations
higher pulls, ranging from 625 to 20,000 nM when transfected using electroporation.
RNA isolation RNA analysis can be performed on total cell RNA or poly (A) + mRNA.
RNA isolation methods are well known in the art.
The RNA is prepared using methods well known in the art, for example, using the TRIZOLO reagent (Invitrogen, Carisbad, CA) according to the protocol recommended by the manufacturer.
Analysis of inhibition of levels or target expression The inhibition of levels or expression of a transthyretin nucleic acid can be evaluated in a variety of ways known in the art.
For example, target nucleic acid levels can be quantified, for example, by Northern blot analysis, by competitive po-: limerase chain reaction (PCR), or by quantitative real-time PCR.
The RNA thirst analysis can be performed on total cell RNA or poly (A) + mRNA. : RNA isolation methods are well known in the art.
Northern blot analysis is also routine in the technique.
Quantitative real-time PCR can be conveniently performed using the commercially available ABI PRISMO 7600, 7700, ou7900 sequence detection system, available from PE-Applied Biosystems, Foster City, CA and used according to the manufacturer's instructions.
Quantitative real-time PCR analysis of target RNA levels Quantification of target RNA levels can be performed by quantitative real-time PCR using the ABI PRISMO 7600, 7700, or 7900 sequence detection system (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions.
Quantitative real-time PCR methods are well known in the art.
Before real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA - (cDNA) which is used as a substrate for real-time PCR amplification.
Real-time RT and PCR reactions are performed sequentially in the same sample well.
Real-time RT and PCR reagents are obtained from Invitrogen (Carlsbad, CA). Real-time RT and PCR reactions are performed by methods known to those skilled in the art.
The amounts obtained from the target gene (or RNA) by PCR are normalized using the expression level of a gene whose expression is constant, such as Cyclophylline A, or by quantifying the total RNA using RIBOGREEN & (Invitrogen, Inc.
Carlisbad, CA). The expression of Cyclophylline A is quantified by real-time PCR, simultaneously running with the target, multiplexing, or separately.
Total RNA is quantified using the RIBOGREEN RNA quantification reagent (Invitrogen, Inc.
Eugene, OR). Methods of quantifying RNA by RIBO-GREENO are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). The CYTOFLUOR & 4000 instrument (PE Applied Bio-systems) is used to measure the fluorescence of RIBOGREEN. "Probes and primers are designed to hybridize to one: 15 transthyretin nucleic acid.
Methods for designing probes and: real-time PCR primers are well known in the art and may include the use of software such as PRIMER EXPRESS O (Applied Biosystems, Foster City, CA). Analysis of protein levels Antisense inhibition of transthyretin nucleic acids can be assessed by measuring transthyretin protein levels.
Levels of transthyretin protein can be evaluated or quantified in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), immunoenzymatic assay (E-LISA), quantitative protein assays, assays protein activity (eg, caspase activity assays), immunohistochemistry, immunocytochemistry or labeled cell fluorescence analysis (FACS). Antibodies directed at a target can be identified and obtained from a variety of sources, such as the MSRS antibody catalog (Aerie - Corporation, Birmingham, MI), or can be prepared using conventional monoclonal antibody generation methods or known in the art.
Antibodies useful for the detection of human and rat transthyretin are commercially available.
In vivo testing of antisense compounds Antisense compounds, for example, antisense oligonucleotides, are tested on animals to assess their ability to inhibit transthyretin expression and produce phenotypic changes.
The tests can be carried out on normal animals or on experimental models of disease.
For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate saline buffer.
Administration includes parenteral routes of administration.
After a period of treatment with antisense oligonucleotides, RNA is isolated from tissue and changes in transthyretin nucleic acid expression are measured.
Changes in transthyretin protein levels are also measured. - Certain compounds: 15 Approximately two hundred and forty-six antisense compounds re-! The newly designed cells of various lengths, motifs and compositions have been tested for their effect on human transthyretin MRNA in vitro in various types of cells.
The new compounds were compared with about six and nine previously designed compounds, including ISIS NOs. 304267, 304268, 304280, 304284, 304285, 304286, 304287, 304288, 304289, 304290, 304291, 304292, 304293, 304294, 304296, 304297, 304298, 304299, 304300, 304301, 304302, 304303, 304304, 304307, 304309, 304311 and 304312 which previously proved to be one of the most potent antisense compounds in vitro (see, for example, US patent publication 2005/0244869 and US2009 / 0082300). Of the approximately three hundred and twenty-five newly designed and previously designed antisense compounds, approximately fifteen compounds have been selected for a more detailed study based on in vitro potency.
The selected compounds were tested for potency and tolerability in a transgenic mouse model (see example 10). Of the fifteen compounds tested, eleven were selected and tested for systemic tolerability (see example 11) and liver half-life measurement
(see example 12) in CD1 mice and also for systemic tolerability (see example 13) and pharmacokinetic studies of the oligonucleotide concentration in the liver (see example 14) in Sprague-Dawley rats. Of these studies, seven compounds were tested for inhibition and dose-dependent tolerability in transgenic mice (see example 15). In addition, fifteen additional compounds were selected from Table 1 and six additional compounds with various motifs were designed with sequences superimposed on ISIS 420951, which indicated high potency and tolerability in the aforementioned assays. These additional compounds were compared with ISIS 420951 for potency and tolerability in transgenic mice (see example 16). Based on all of these studies (examples 10-16) twenty-two compounds were selected and tested for systemic tolerability in CD1 mice (see example. 17). Seven compounds were considered tolerable in the murine model and were subsequently tested for systemic tolerability in Sprague Dawley rats: (see example 18) and in pharmacokinetic studies of the concentration of oligo- It is nucleotide in the liver and kidney (see example 19) . The seven compounds were also tested for dose-dependent potency in transgenic mice (see example 20).
The final evaluation of these studies (examples 16-20) led to the selection of nine compounds that have a sequence of nucleobases from a sequence reported in SEQ ID NO: 25, 78, 80, 86, 87, 115, 120, 122 and 124. Due to their complementary sequence, the compounds are complementary to regions 505-524, 507-526, 508-527, 513-532, 515-534, 516-535, 580-599,585-604,587-606 or 589-608 from SEQ ID NO: 1. In certain embodiments, compounds targeting the listed regions, as described here, consist of a modified oligonucleotide that has some nucleobase part of the sequence reported in SEQ ID NO, as described here. In certain embodiments, compounds targeting the listed regions or containing a nucleobase part of a sequence reported in the listed SEQ ID NOs can be of various lengths, as described here, and can have one of several reasons, as described here. In certain modalities
a compound labeled for a region or containing a nucleotide part of a sequence reported in the listed SEQ ID NOs has the length and specific reason as indicated by ISIS NOs: ISIS 304299, ISIS 420913, ISIS 420915, ISIS 420921 , ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS 420959.
The nine compounds containing a nucleobase sequence from a sequence reported in SEQ ID NO: 25, 78, 80, 86, 87, 115, 120, 122 and 124, were subsequently tested for dose-dependent inhibition in primary hepatocytes of the monkey cynomolgus (see example 21). These compounds were also tested for optimal viscosity (example 22). The liver half-life of CD1 mice from seven of the compounds that have a sequence of nucleobases from a sequence reported in SEQ ID NOs: 78, 86, 87, 115, 120 and 124 were also evaluated (example 23). - The final evaluation of these studies (examples 1-23) led to the se-: 15 selection of eight compounds that have a nucleobase sequence of a 'sequence reported in SEQ ID NO: 25, 80, 86, 87, 115, 120, 122 and 124. Because of their complementary sequence, the compounds are complementary to regions 504-523, 505-524, 512-531, 513-532, 577-596, 582-601, 584-603 and 605-586 of SEQ ID NO: 1. In certain embodiments, the compounds labeled for the listed regions, as described here, consist of a modified oligonucleotide that has some nucleobase part of the sequence reported in SEQ ID NO, as described here. In certain modalities, compounds targeting the listed regions or containing a nucleobase part of a sequence reported in the listed SEQ ID NOs can be of various lengths, as described here and can have one of several reasons, as described on here. In certain embodiments, a compound labeled for a region or containing a nucleobase part of a sequence reported in the listed SEQ ID NOs has the specific length and motif as indicated by ISIS NOs: ISIS 304299, ISIS 420915, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS
420959.
These eight compounds were tested for efficacy, the pharmaceutical profile
macokinetic and tolerability in cynomolgus monkeys (example 24). Inhibition studies in these monkeys indicated that treatment with some of these compounds caused high inhibition of TTR MRNA in the liver. Specifically, treatment with IS-IS 420950, ISIS 420955 and ISIS 420915 caused inhibition of 91%, 79% and 78%, compared to the PBS control, respectively. ISIS420915 was found to cause greater inhibition of TTR MRNA (78%) compared to ISIS 304299 (59%), even though the two oligonucleotides differ from each other by a single change of base pairs in their target region in SEQ ID NO : 1. The protein analysis also complemented the data from the RNA analysis with the treatment with ISIS 420915 causing 76% inhibition and with the ISIS 304299 treatment causing 47% inhibition of the TTR protein compared with the control. Levels of the RBP4 protein, as a protein associated with transthyretin, were also expected to decrease after treatment with the antisense compounds. Levels of RBP4 protein decreased by 63% after treatment with ISIS 420915. Treatment with ISIS 304299 decreased levels of protein by 19%. teina RBP4. In addition, ISIS 420915 was more tolerable than ISIS 304299, as indicated in the monkey study (example 24). The transaminase levels of monkeys treated with ISIS 304299 (ALT 81 IU / L and AST 101 IU / L) were higher than those treated with ISIS 420915 (ALT 68 IU / L and AST 62 IU / L). The C3 complement levels of monkeys treated with ISIS 304299 (96 mg / dL) were lower than those of monkeys treated with ISIS 420915 (104 mg / dL).
Thus, antisense compounds with one or more of the improved characteristics are provided here. In certain embodiments, compounds are provided herein comprising a modified oligonucleotide as described herein as a target for, or especially as hybridizable to, the nucleotide region of SEQ ID NO: 1. Thus, antisense compounds with one or more are provided here. more of the improved features. In certain embodiments, compounds are provided herein comprising a modified oligonucleotide as described herein as a target for, or especially as hybridizable to, the nucleotide region of SEQ ID NO: 2.
Thus, antisense compounds with one or more of the improved characteristics are provided here. In certain embodiments, compounds are provided herein which comprise a modified oligonucleotide as described herein as a target for, or especially as hybridizable to, the nucleotide region of SEQ ID NO: 4).
In certain embodiments, the compounds as described herein are effective in that they have at least one of an ICrs, in vitro of less than 2.9 µM, less than 2.2 µM, less than 2.0 µM, less than 1.5 µM, less than 1.4 µM, less than 1.3 µM, less than 1.0 µM, less than 0.7 µM, less than 0.6 µM, when administered to a cell line of cynomolgous monkey heptocyte using electroporation as described in Example 67. In certain embodiments, the compounds as described here: are highly tolerable as shown to contain at least one. 15 ALT or AST value increased by no more than 4 times, 3 times, or 2: times in relation to animals treated with saline; or an increase in weight * of the liver, spleen or kidney of not more than 30%, 20%, 15%, 12%, 10%, 5% or 2%. Certain indications In certain embodiments, methods are provided here for treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has a disease related to the central nervous system.
As shown in the examples below, the compounds labeled for transthyretin as described here have been shown to reduce the severity of the physiological symptoms of diseases related to the central nervous system. In some of the experiments, the compounds reduced the rate of formation of amyloid plaques, for example, the animals continued to experience symptoms, but the symptoms were less severe compared to untreated animals. In other experiments, however, the compounds appear to result in the regeneration of function over time; for example, animals treated for a long period of time
9 // 232 had less severe symptoms than those who received the compounds for a short period of time. The ability of the compounds, exemplified below, to restore function, therefore, demonstrates that the symptoms of the disease can be reversed by treatment with a compound as described here.
Thus, methods are provided here to improve a symptom associated with a disease related to the central, cardiac, neuropathological or gastrointestinal system in a patient in need of it. In certain modalities, a method is provided to reduce the rate of the appearance of a symptom associated with a disease related to the central, cardiac, neuropathological or gastrointestinal system. In certain embodiments, a method is provided to reduce the severity of a symptom associated with the central, cardiac, - neuropathological or gastrointestinal system. In these modalities, the methods. 15 comprise administering to a subject in need of a therapeutically effective amount of a Y-directed compound a transthyretin nucleic acid.
Transthyretin amyloidosis is characterized by several physical, neurological, psychiatric and / or peripheral symptoms. Any symptom known by a person skilled in the art to be associated with transthyretin amyloidosis can be alleviated or otherwise modulated as defined above in the methods described above. In certain modalities, the symptom is a physical, cognitive, psychiatric, or peripheral symptom. In certain modalities, the symptom is a physical symptom selected from the group consisting of agitation, lack of coordination, nystagmus, spastic paraparesis, lack of muscle coordination, visual impairment, insomnia, unusual sensations, myoclonus, blindness, speech loss, carpal tunnel, attacks, subarachnoid hemorrhage, stroke and hemorrhage in the brain, hydrocephalus, ataxia and spastic paralysis, coma, sensory neuropathy, paraesthesia, - hypesthesia, motor neuropathy, autonomic neuropathy, orthostatic hypotension, cyclical constipation, cyclic diarrhea , nausea, vomiting, reduced sweating, impotence, delayed gastric emptying, urinary retention, incontinence
urinary dysfunction, progressive heart disease, fatigue, difficulty breathing, weight loss, lack of appetite, numbness, tingling, weakness, macroglossia, nephrotic syndrome, congestive heart failure, exertional dyspnea, peripheral edema, arrhythmias, palpitations, dizziness, syncope, hypotension postural, peripheral nerve problems, motor sensory deficiency, lower limb neuropathy, upper limb neuropathy, hyperalgesia, altered temperature sensation, lower extremity weakness, cachexia, peripheral edema, hepatomegaly, purple, diastolic dysfunction, against - premature ventricular conditions, cranial neuropathy, reduced reflexes of the deep tendon, amyloid deposits in the vitreous body, vitreous opacity, dry eyes, glaucoma, curved appearance in the pupils, swelling of the feet due to water retention.
In certain modalities, the symptom is a cognitive symptom selected from the group consisting of impaired memory, deficiency of judgment and thought, impaired planning, flexibility. 15 committed, abstract compromised thinking, compromised rule acquisition, compromised initiation of appropriate actions, inhibited 'wrong actions compromised, damaged short-term memory, damaged long-term memory, paranoia, disorientation, confusion, hallucination and insanity.
In certain modalities, the symptom is a psychiatric symptom selected from the group consisting of dementia, anxiety, depression, blunted affection, egocentrism, aggressiveness, compulsive behavior, irritability, personality changes, including impaired memory,
judgment and suicidal thinking and idealization.
In certain embodiments, the symptom is agitation.
In certain modes, the symptom is a lack of coordination.
In certain modalities, the symptom is nystagmus.
In certain modalities, the symptom is spastic paraparesis.
In certain modalities, the symptom is lack of muscle coordination.
In certain modalities, the symptom is impaired vision.
In certain modalities, the symptom is insomnia.
In certain modalities, the symptom is unusual sensations. In certain modalities, the symptom is myoclonus.
In certain modalities, the symptom is blindness.
In certain modalities, the symptom is loss of speech.
In certain modalities, the symptom is carpal tunnel syndrome.
In certain
In these modalities, the symptom is seizure.
In certain modalities, the symptom is subarachnoid hemorrhage.
In certain modalities, the symptom is stroke.
In certain modalities, the symptom is bleeding in the brain.
In certain modalities, the symptom is hydrocephalus.
In certain modalities, the symptom is ataxia. In certain modalities, the symptom is spastic paralysis.
In certain modalities, the symptom is coma.
In certain modalities, the symptom is sensory neuropathy.
In certain modalities, the symptom is paresthesia.
In certain modalities, the symptom is hypoesthesia.
In certain modalities, the symptom is motor neuropathy.
In certain modalities, the symptom is autonomic neuropathy In certain modalities, the symptom is orthostatic hypotension.
In certain modalities, the symptom is cyclical constipation.
In certain modalities, the symptom is cyclic diarrhea.
In certain modalities, the symptom is nausea.
In certain modalities, the symptom is vomiting.
In certain modalities, the symptom is: reduced sweating.
In certain modalities, the symptom is impotence.
In certain modalities, the symptom is slow gastric emptying.
In certain fashion, the symptom is urinary retention.
In certain modalities, the symptom is. urinary incontinence.
In certain modalities, the symptom is progressive heart disease.
In certain modalities, the symptom is fatigue.
In certain modalities, the symptom is shortness of breath.
In certain modalities, the symptom is weight loss.
In certain modalities, the symptom is numbness.
In certain modalities, the symptom is tingling.
In certain modalities, the symptom is weakness.
In certain modalities, the symptom is macroglossia.
In certain modalities, the symptom is nephrotic syndrome.
In certain modalities, the symptom is Congestive heart failure.
In certain modalities, the symptom is effortless.
In certain modalities, the symptom is peripheral edema.
In certain modalities, the symptom is arrhythmia.
In certain modalities, the symptom is palpitation.
In certain embodiments, the symptom is dizziness.
In certain modalities, the symptom is syncope.
In certain modalities, the symptom is postural hypotension.
In certain modalities, the symptom is a problem of the peripheral nerves.
In certain modalities, the symptom is sensory motor deficiency.
In certain modalities, the symptom is lower limb neuropathy.
In certain modalities, the symptom is neuropathy of the upper limbs
«N 100/232 * res.
In certain modalities, the symptom is hyperalgesia.
In certain modalities, the symptom is a sensation of altered temperature.
In certain modalities, the symptom is weakness of the lower extremities.
In certain modalities, the symptom is cachexia.
In certain modalities, the symptom is edema.
In certain modalities, the symptom is hepatomegaly.
In certain modalities, the symptom is purple.
In certain embodiments, the symptom is dysstolic dysfunction.
In certain modalities, the symptom is premature ventricular contractions.
In certain modalities, the symptom is cranial neuropathy.
In certain modalities, the symptom is a decrease in the reflexes of the deep tendon.
In certain embodiments, the symptom is amyloid deposits in the vitreous body.
In certain embodiments, the symptom is glassy opacity.
In certain modalities, the symptom is dry eyes.
In certain modalities, the symptom is glaucoma.
In certain embodiments, the symptom is curved appearance in the pupils.
In . in certain modalities, the symptom is swelling of the feet due to fluid retention 7 In certain modalities, the symptom is impaired memory. * In certain modalities, the symptom is judgment and compromised thinking.
In certain modalities, the symptom is a lack of planning.
In certain modalities, the symptom is compromised flexibility.
In certain modes, the symptom is compromised abstract thinking.
In certain modalities, the symptom is compromised rule acquisition.
In certain modes, the symptom is compromised initiation of appropriate actions.
In certain modalities, the symptom is impaired inhibition of improper actions.
In certain modalities, the symptom is impaired short-term memory.
In certain modalities, the symptom is impaired long-term memory.
In certain modalities, the symptom is paranoia.
In certain modalities, the symptom is disorientation.
In certain modalities, the symptom is confusion.
In certain modalities, the symptom is hallucination.
In certain modalities, the symptom is dementia.
In certain modalities, the symptom is dementia.
In certain modalities, the symptom is anxiety.
In certain modalities, the symptom is depression.
In certain modalities, the affective dullness symptom.
In certain
'101/232 x modalities, the symptom is self-centeredness. In certain modalities, the symptom is aggression. In certain modalities, the symptom is compulsive behavior. In certain modalities, the symptom is irritability. In certain modalities, the symptom is personality change. In certain modalities, the symptom is suicidal idealization.
In certain embodiments, methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein are provided here. In certain modalities, the individual has a disease related to the central nervous system. In certain modalities, the administration of an antisense compound labeled for a transthyretin nucleic acid results in a reduction of transthyretin expression by at least 15, 20, 25, 30, 35, 40, 45, 50, - 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99% or within an interval defined by two of these values.
: In certain embodiments, pharmaceutical compositions comprising an antisense compound labeled for transthyretin are used for the preparation of a medicament for the treatment of a patient who is suffering from or is susceptible to a disease related to the central nervous system.
In certain embodiments, the methods described here include administering a compound comprising a modified oligonucleotide containing a portion of contiguous nucleobases, as described here from a sequence reported in SEQ ID NO: 25, 78, 80, 86, 87, 115, 120, 1220124 Administration In certain embodiments, the compounds and compositions as described here can be administered in a number of ways depending on whether the desired treatment is local or systemic and the area to be treated Administration can be topical , pulmonary, for example, by inhalation or insufflation of powders or aerosols, including nebulization; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. The compounds and
Only 102/232 compositions as described herein can be administered in order to target a specific tissue, such as the liver or brain.
In certain embodiments, the compounds and compositions as described herein are administered parenterally. "Parenteral administration" means administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration or intracranial administration, for example, intracerebral administration, intrathecal administration, ventricular administration, ventricular administration , intracerebroventricular administration, cerebral ventricular administration or cerebral ventricular administration. Administration can be continuous, or chronic, or short or intermittent.
In certain modalities, parenteral administration is by infu-. are. The infusion can be chronic or continuous, or short or intermittent. In certain embodiments, the infused pharmaceutical agents are administered with a pump. In certain embodiments, parenteral administration is by injection.
In certain modalities, parenteral administration is subcutaneous.
In other embodiments, the formulation for administration consists of the compounds described here and saline.
In certain embodiments, compounds and compositions are administered to the CNS. In certain embodiments, the compounds and compositions are administered to the cerebrospinal fluid. In certain embodiments, the compounds and compositions as described herein are administered to the brain parenchyma. In certain embodiments, the compounds and compositions are administered to an animal in multiple regions of the central nervous system (for example, in multiple regions of the brain, and / or in the spinal cord) by intrathecal administration, or intracerebroventricular administration. The wide distribution of the compounds and compositions, described here, within the central nervous system can be achieved with intraparenchymal administration, intrathecal administration, or intracerebroventricular administration.
: 103/232 In certain embodiments, the present invention includes pharmaceutical compositions that can be administered by injection directly into the brain. The injection can be through stereotactic injection in a particular region of the brain (for example, the substance nigra, choroid plexus, cortex, hippocampus, striatum, choroid plexus or globus pallidus). The compound can also be administered to diffuse regions of the brain (for example, diffuse administration to the brain cortex). In certain modalities, parenteral administration is by injection. The injection can be administered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain modalities, the injection is administered directly into a tissue, such as striatum, caudate, cortex, hippocampus and cerebellum.
In certain embodiments, the administration of a compound or. composition described herein can affect the pharmacokinetic profile of the compound. 15 or composition. In certain embodiments, the injection of a compound or composition described herein, into a target tissue improves the pharmacokinetic profile of the compound or composition, compared to the infusion of the compound or composition. In a given modality, the injection of a compound or composition improves potency compared to widespread diffusion, requiring less of the compound or composition to achieve similar pharmacology. In certain embodiments, similar pharmacology refers to the amount of time that a target mMRNA and / or a target protein is unregulated (for example, the duration of action). In certain embodiments, methods of specific location of a pharmaceutical agent, such as by bolus injection, decrease the average effective concentration (EC50) by a factor of about 50 (for example, 50 times less concentration in the tissue is required to achieve the same or similar pharmacodynamic effect). In certain modalities, the methods of specific location of a pharmaceutical agent, such as by bolus injection, decrease the average effective concentration (EC50) by a factor of 20, 25, 30, 35, 40, 45 or 50. In certain modes, The pharmaceutical agent is an antisense compound as described here. In certain embodiments, the target tissue is brain tissue. In certain
«Modalities, the target tissue is striatal tissue.
In certain modalities, the decrease in EC50 is desirable because it reduces the dose needed to achieve a pharmacological result in a patient in need of it.
The half-life of the gapmer MOE oligonucleotides in the tissue of the CD1-all mice is approximately 21 days (see examples 12). In certain modalities, an antisense oligonucleotide is administered by injection or infusion once every month, every two months, every 90 days, every 3 months, every 6 months, twice a year or once a year .
Certain combination therapies In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents.
In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder or condition as one or more of the pharmaceutical compositions described herein.
In: certain embodiments, said one or more other pharmaceutical agents are designed to treat a disease, disorder or condition other than the one or more pharmaceutical compositions described here.
In certain embodiments, said one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions as described herein.
In certain embodiments, one or more compositions are co-administered with another pharmaceutical agent to treat an undesired effect from that other pharmaceutical agent.
In certain embodiments, one or more pharmaceutical compositions are co-administered with another pharmaceutical agent to produce a combinatorial effect.
In certain embodiments, one or more pharmaceutical compositions are co-administered with another pharmaceutical agent to produce a synergistic effect.
In certain embodiments, one or more pharmaceutical compositions and one or more other pharmaceutical agents are administered at the same time.
In certain embodiments, one or more pharmaceutical compositions and one or more other pharmaceutical agents are administered at different times.
In certain embodiments, one or more pharmaceutical compositions
Pharmaceuticals and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions and one or more other pharmaceutical agents are prepared separately.
In certain embodiments, the second compound is administered prior to administration of a pharmaceutical composition of the present invention. In certain embodiments, the second compound is administered after administration of a pharmaceutical composition of the present invention. In certain embodiments, the second compound is administered at the same time as a pharmaceutical composition of the present invention. In certain embodiments, the dose of the second coadministered compound is the same as the dose that should be administered if the second compound were administered alone. In certain embodiments, the dose of a second compound. co-administered is less than the dose that should be administered if the. 15 second compound was administered alone. In certain embodiments, the: dose of a second co-administered compound is greater than the dose that would have been administered if the second compound were administered alone. In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, so that the co-administration of the compounds results in an effect that is greater than the effect of the first compound administered alone. In certain embodiments, co-administration results in effects that are additive to the effects of the compounds when administered alone. In certain embodiments, co-administration results in effects that are super-additive to the effects of the compounds when administered alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound. In certain embodiments, pharmaceutical agents that can be co-administered with a pharmaceutical composition of the present invention include antipsychotic agents, such as, for example, haloperidol, chlor-promazine, clozapine, quetiapine, and olanzapine; antidepressant agents, such as, for example, fiuoxetine, sertraline hydrochloride, venlafaxine and nortripti-
blade; tranquilizing agents, for example, benzodiazepines, clone zepam, paroxetine, venlafaxine and beta-blockers; mood stabilizing agents such as, for example, lithium, valproate, lamotrigine and carbamazepine; paralyzing agents, such as botulinum toxin; and / or other experimental agents, including, but not limited to, tetrabenazine (Xenazine), creatine, coenzyme Q10, trehalose, docosahexanoic acids, ACR16, ethyl-EPA, atomoxetine, citalopram, dimebon, memantine, sodium phenylbutyrate, ramelteon, ursodiol, zyprexa, xenasine, tiapride, riluzole, amantadine, [1231] MNI-420, atomoxetine, tetrabenazine, digoxin, dextromethorphan, warfarin, —alprazolam, ketoconazole, omeprazole and minocycline.
In certain embodiments, pharmaceutical agents that can be co-administered with a pharmaceutical composition of the present invention include analgesics, such as paracetamol (acetaminophen); anti-inflammatory drugs. non-steroids (NSAIDs), such as salicylates; narcotic drugs, such as, morphine synthetic edrugs with narcotic properties, such as tramadol.
: In certain embodiments, pharmaceutical agents that can be co-administered with a pharmaceutical composition of the present invention include muscle relaxants, such as benzodiazepines and metocarbamol. Formulations The compounds of the invention can also be mixed, conjugated or otherwise associated with other molecules, molecular structures or mixtures of compounds, for example, liposomes, target molecules of receptors, or other formulations, to aid in uptake , distribution and / or absorption. Representative United States patents that teach the preparation of said formulations that aid in the capture, distribution and / or absorption include, among others, US patents: 5,108,921;
5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932;
5,583,020; 5501721; 4426330; 45348609 SO0I3.556; 9,108,927,
5,213,804; 5,227,170, 5,264,221; 5,356,633; 5,395,619, 5,416,016; 90 541/9/8 5462854 BASUGSA4 0512295 552/528 0534259
5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is incorporated by reference.
The antisense compounds of the invention comprise any salt, esters or salts of such pharmaceutically acceptable esters, or any other compound which, after being administered to an animal, including a human, is capable of providing (directly or indirectly) the biological metabolite. active or residue of the same.
The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of compounds of the invention, that is, salts that retain the desired biological activity of the parent compound and do not impart their respective undesirable toxicological effects. For —oligonucleotides, the preferred examples of pharmaceutically acceptable salts and their uses are described in US patent 6,287,860, which is incorporated here in its entirety. Sodium salts have been shown to be suitable forms of oligonucleotide drugs.
. The present invention also includes pharmaceutical compositions and formulations that include the antisense compounds of the invention. The pharmaceutical compositions of the present invention can be administered in a number of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, for example, intracerebral administration, intrathecal administration, intraventricular administration, ventricular administration, intraceptovascular administration, cerebral intraventricular administration or cerebral ventricular administration.
Intraventricular administration is preferred for the expression of the target transthyretin in the choroid plexus. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical vehicles, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Condoms
dresses, gloves and the like can also be helpful.
The pharmaceutical formulations of the present invention, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques known in the pharmaceutical industry. Such techniques include the step of associating active ingredients with pharmaceutical vehicles or excipients. In general, formulations are prepared uniformly and intimately by placing the active ingredients in combination with liquid vehicles or finely divided solid vehicles or both, and then, if necessary, mold the product.
The compositions of the present invention can be formulated in any of the many possible dosage forms, such as, among others, tablets, capsules, gel capsules, liquids, syrups, gels. lesions, suppositories and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may still contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.
The pharmaceutical compositions of the present invention include, among others, solutions, emulsions, foams and formulations containing liposomes. The pharmaceutical compositions and formulations of the present invention can include one or more penetration enhancers, vehicles, excipients or other active or inactive ingredients.
Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets, generally greater than 0.1um in diameter. Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in the aqueous phase, oily phase or itself as a stopped phase. Microemulsions are included as a modality of the present invention. Emulsions and their uses are well known in the art and are further described in US patent 6,287,860, which is incorporated herein in its entirety.
The formulations of the present invention include formulations | As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids, organized in a spherical bilayer or bilayer. Liposomes are unilamellar or multilamellar vesicles, which have a membrane formed of a lipophilic material and an aqueous interior that contains the composition to be administered. Cationic liposomes are positively charged liposomes that we believe interact with negatively charged DNA molecules to form a stable complex. Liposomes that are sensitive to pH or negatively charged are believed to trap DNA rather than form complex with it. Cationic and non-cationic liposomes have been used to deliver DNA to cells. . Liposomes also include "sterically stable" liposomes, a term that, as used here, refers to liposomes made up of one or more specialized lipids that, when incorporated into liposomes, result in an increase in the life span of circulation in relation to deficient liposomes of said specialized lipids. Liposomes and their uses are described in US patent 6,287,860, which is incorporated here in its entirety.
In another embodiment of the invention, formulations of the present invention include saline formulations. In certain embodiments of the invention, a formulation consists of the compounds described herein and saline. In certain embodiments, a formulation consists essentially of the compounds described here and saline. In certain embodiments, the saline solution is a pharmaceutically acceptable grade saline solution. In certain embodiments, the saline solution is a buffered saline solution. In certain embodiments, the saline solution is the phosphate buffered saline (PBS).
In certain embodiments, a formulation excludes liposomes.
In certain embodiments, the formulation excludes sterically stabilized liposomes. In certain embodiments, a formulation excludes phospholipids. In certain embodiments, the formulation consists essentially of the compounds described here and saline and excludes liposomes.
The pharmaceutical formulations and compositions of the present invention can also include surfactants. Surfactants and their uses are described in US patent 6,287,860, which is incorporated herein in its entirety. In one embodiment, the present invention employs various penetration enhancers to affect the efficient delivery of nucleic acids, particularly oligonucleotides. Penetration intensifiers and their uses are described in US patent 6,287,860, which is fully incorporated here.
One skilled in the art will recognize that the formulations are routinely designed according to their intended use, that is, route of administration.
. Preferred formulations for topical administration include those in which the oligonucleotides of the invention are mixed with a topical administration agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral ones (eg, dioleoyl-phosphatidi-ethanolamine DOPE, dimyristoylphosphatylcholine DMPC, distearol-phosphatidylcholine), negatives (eg, dimyristoyl phosphatidyl glycerol DMPG) and cationic (eg, tetramethyl diol) aminopropyl DOTAP and dioleoyl phosphatidyl ethanolamine DOTMA).
Compositions and formulations for parenteral administration, including intravenous, intraarterial, intraperitoneal, intramuscular, or intracranial injection or infusion may include sterile aqueous solutions that may also contain buffers, thinners and other appropriate additives such as, among others, penetration enhancers, carrier compounds and other pharmaceutically acceptable vehicles or excipients.
Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents that function through a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, arabinosidic cytosine, bis-chloroethyl, nitrosamine, actin, nitrosamine, actinamine, mitochloride, nitrosamine, actinamine, actinamine D, mitramycin, prednisone, hydroxypro- - gesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethyl-melamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methyl-cyclohexylnitrosureia, 6-nitrogen, tetrahydrate, merchants, 6- , cytarabine, 5-azacytidine, hydroxyurea, deoxyco-formicin, 4-hydroxiperoxycyclophosphoramide, 5-fluorouracil (5-FU) 5-fluordeoxy-uridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vimblasti- , etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, said chemotherapeutic agents can be used individually. individually (for example, 5-FU and oligonucleotide), sequentially (for example, 5-FU and oligonucleotide for a period of time followed by MTX ê and oligonucleotide), or in combination with one or more of said chemotherapeutic agents (for example, 5-FU, MTX and oligonucleotide or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including other non-steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribavirin, vidarabine, acyclovir, and ganciclovir, can also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more compounds combined can be used together or sequentially.
In another related embodiment, the compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeting a first nucleic acid and one or more additional antisense compounds targeting a second target nucleic acid. Alternatively, the compositions of the invention may contain two or more antisense compounds labeled for different regions of the same target nucleic acid. Numerous examples of antisense compounds are known in the art. Two or more compounds combined can be used together or sequentially. Dosage The formulation of therapeutic compositions and their subsequent administration (dosage) are believed to be within the skill of experts in the art. The dosage is dependent on the severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until the cure is carried out or a decrease in the disease state is achieved. Optimal dosage schemes can be calculated from measurements of drug accumulation in the patient's body. The optimal dosage can vary depending on the relative potency of the individual oligonucleotides, and can generally be estimated based on EC50s which have been shown to be effective in vitro and in vivo in animal models. In general, the dose is 0.01 µg to 100 g. per kg of body weight, and can be given once or more daily, weekly, monthly or annually, or at desired intervals. After successful treatment, it may be desirable to keep the patient undergoing maintenance therapy to prevent recurrence of the disease state, where the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, one or more times daily.
Although the present invention has been specifically described according to some of its preferred embodiments, the following examples serve only to illustrate the invention and not as an attempt to limit them. Each of the references, access numbers in —GENBANK and the like reported in this application is incorporated herein by reference in its entirety.
EXAMPLES Disclosure and non-limiting incorporation by reference While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain modalities, the following examples serve only to illustrate the compounds described here and are not limited to the same . Each of the references
113/2832 | reported in this application is incorporated herein by reference in its entirety.
Example 1: Antisense inhibition of human transthyretin in HepG2 cells The antisense oligonucleotides were designed to be labeled for transthyretin nucleic acid and were tested for their effects on transthyretin RNA in vitro. HepG2 cells grown at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM of the antisense oligonucleotide. After a 24-hour treatment period, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer set RTS1396 (direct sequence CCCTGCTGAGCCCCTACTC, designated here as SEQ ID NO: 5; reverse sequence TECCTCATTCCTTGGGATTG, designated here as SEQ ID NO: 6; probe sequence ATTCCACCACGGCTGTCGTCAX, designated here as the SEQ 7 NO: 7 ). The transthyretin MRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of inhibition of transthyretin in relation to untreated control cells.
The chimeric antisense oligonucleotides in the complexion Tables were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleotides long, where the central opening segment is composed of ten 2'-deoxynucleotides and is flanked on both sides (in the 5 'and 3 directions)) by the flanks that comprise five nucleotides each Each nucleotide in the 5 'flanking segment and each nucleotide in the 3' flanking segment has a 2 'MOE modification. The inter-nucleoside bonds along each gapmer are phosphoroticate bonds (P = S). All cytidine residues along each gapmer are 5-methylcytidines. The "human target start site" indicates the outermost 5 'nucleotide in the —qualogapmeré labeled for the human gene sequence. The "human target end site" indicates the outermost 3 'nucleotide in which the gapmer is marked for the human gene sequence. Each gapmer listed on the
bela 1 is directed to the human transthyretin MRNA, designated here as SEQ ID NO: 1 (GENBANK accession number NM 000371.2). Certain gapmers have also been designed whose target intronic sequences or intron-exon junctions of the human genomic transthyretin sequence, called aquicomoSEQ ID NO: 2 (GENBANK accession number. NT 010966.10 truncated from nucleotide 2009236 to 2017289) and are listed in Table 2.
The human oligonucleotides in Tables 1 and 2 also cross-react with sequences of rhesus monkey genes. The 'mismatches' indicate the number of nucleobases, by which the human oligonucleotide is not correctly paired with a sequence of rhesus monkey genes. The greater the complementarity between the human oligonucleotide and the sequence of the rhesus monkey, the greater the possibility of the human oligonucleotide to generate a cross reaction with the sequence of the rhesus monkey. The human oligonucleotides in Table 1 were: compared with exons 141 extracted from the genomic sequence of the rhesus monkey of Accession No. in GENBANK NW 001105671.1, based on similarity with human exons. The human oligonucleotides in Table 2 were compared to the genome sequence of the rhesus monkey, designated here as SEQ ID NO: 4 (GENBANK accession number NW 001105671.1 truncated from nucleotide 628000 to 638000). The "rhesus monkey target start site" indicates the outermost 5 'nucleotide in which the gapmer is marked for the rhesus monkey gene sequence. The "target rhesus monkey interruption site" indicates the outermost 3 'nucleotide on which the —gapmeré is labeled for the rhesus monkey gene sequence.
a o: 2 ojo 2/58/28 8/8 8 els g / 2 / 2jo; SÉ 22S als 2588 Ass already | 512 s8s SSIS 852/28 õ Ss without 2/8 8 3 8/2 2/2 5/8/5228 õ SS 8 2/38/23 / 3/8 / É 8 / 29/88: a | E and ES / S 8 3/8 81212 E) o O Sd E / 5/2/2/5/3/2/3/8] 8 9/8158 o O Ss <É / S5 SI8 | 2 3/8 / 8888 FR O Ê <SS 3B / S / 5/8] 8 o $ | E | º SIEISS O Ps 8/8/8 / S | SE Ss AHHAHA NAAS = BSS SSIS € 58 OE 8 Ss o 2 0 / 0 fo) sis 5 53 Ss FIO l <ISIoO S | 8 / O IS 8 SIS RIO og ElEJEIS / 88 Be the 58/28/3216 3E / 5/518/8 EB and the 8 [EI SSB ZISIS S / s S e So S&S S85 / 818 / É Ss 2/8 5/8: E SI8 / 8/8 8 3/2 S / S / 8 0 / s / sa] 2 ú 5 SSB SS BE at 8 / 8k S $ | 2 / S / PIS / 2 | OS á 'n4 $ E 8 EE 5 + oo 3 is SB8 2 9º 883 8 E EE SS Sis ss + gs 2/88 -. 2 8/33 ao 2 2 | 3 | s + 3 8 2 | S + $ / 8/8 | 8 2 The bidla -. elelee so g / 8 / g / e / lejeia 8 WE EL E ER SERRA ERA). 3 8 SIS AND SIE SIS 5/5 If they are HOOOHAooOA 88 8/8 8/8 8/8 8/88/88: & E is 8 8/8 8/8/88
SS 8 v gs are). E | E: o they $ S ss 8 SIS SIS S S / IS / 8 / 8S 8 2 STS TESS BSS 2 E E SRERS TESS g SS joS RSS 3 31 E E | 5 6 o | s e Sl: ss els gs
2.8 & S | S: s Sm SIS IRIS ISIS 2/8 / S 23 8SsaesSEENRER E 2 3 E SERBRESEE 2 9 GENS i i - sales ess Ê RF BF FS S & a Zio assess sENNSS: F | ISS ss SS sSFSssss à | a SBSSSSSAs to sl sSS88 = É LL o <OT Higor El loigio he jo 88 218 E 8/8 RS 6/5 to 8/8 S / s 8 / R a se o PIZIPIleE o Elo o HE o E EI PR OIE [ 0/0] They </ 2 oo jol8 sig SEE 5 9/8 SEE AHAAAHONE o E </ CIES <= o <jO <Sh E El </ </ o 8 a / osigiço SIGIEJO Sd E 8 This is I / O sos o S / S 5 / S 5 AND SIS es and say 5 SS EISIZISIE IS E 8/8 o XI DIB ISO SO 2 IO <| oO 2152 E 3 g / 2/8 22 ES / S / 3 | s SIE EE s iElo SS Elo | RIEIE E 3 2 Ego 8 2/2 o EE = o O o o o 60 60 5/85 Ss SIR5 / 8 / S 3/25 2/0 5 5 0/0 5/0 õ / ooo O <o lo | <<HIrJOIO to Stoa Spas EESEREERRES 8 | SE AND RPE PIR | E IP o | S | PR ER E € Rj ojo L2 2/2/28/2/2/2/2/2 | 2 EE EI S / SEEEE 8 leer ei je je je S SS S 8/8 8 8/8 | s S ES krceeeesL55Sleee se 2 ee e2 / 2 8 | 2I2 / S / S / 5S | S | / 5/5 2/32/32 SS SS SS SSIS & lalala aa alalaal- 9/8/8/8/8/8/8 / 8/8 | 8 | 8 à ê go É 2 = if É 85
IT 2 o lo ln / lo | = link a = | or al = loio | lana ojo = SIR SS SBB Ss s PT o 8 2 FS SS SidlsIos O So / ohbowWwionÁoo oo ox. - a Nie Oo o 0 O m o Ss <8º Tã E ss 2 geSSRZSESESegEsSRTRRESESS o SE SS SS SE s5Ss ossada «NJ Ns 6 | O 2 lalol- | alo tn link sc a e lajolt le e rn elojis Zz So o / o / o0 / 0 / o0 / 0 / O = = | nt Ns NS Ns Nm mis o é NEsBSSE RSS SS SS SS SS Ss ss 8 ss Ss sSsSs Ss sSSsSSRERSSSRESE SS and sSleje and he es e o sv vv lv viv | v | | and is
Hi ox sis pPlISH PIO IO <igl8 / 3 8/8 s / á 8 2/5/8/8/8/3/8 3 S / 8] 5 | 8 Q olE Si jolrH 0 O oo </ O PIE oo 8 dl o PIS og e <jO PIRIOIK IS BIRIGIB RISO IRS 8 2 / £ S El clol <EIS PIS o 58 els Be so EE alo eee se es es eReSP5SsIS | S o <ss Pig PIS alo e Ss o Ss els 8 9/8/89/0 and Sisis o ele 6/0 o 2/2 O Bo e PB E SIE SIgIK Rr / 0 0/20/00 | £ S oo </ oo FEI El6 SlElolo Rr jo oo <B / <| 6/0 El <lolbiolo e E 8/0 8/2/0213 5/8 / S 5 ES / s / 3/9/53 | 8 ca | <| € 5 PR o / 6 2 SS SS PLASTER [8 8 / 2 | E 3 Seal the link and alo and praise o 6/2 2iE | <e [SP 8 o S / SO and S GR ooo PIE E </ ô So and BS RR O 2 o RB E ole E 5 < [o | 5 EEreo No sex HlOoIOIOIK | O 3 Bs and 2 8 8 RS Pio and EIS PIEIS SR Rojo o SB BS Ss SE Ss Pio o PI olElosjo | R | Ejojojo mer
E EE PI DS 1) BElais olojo | o SR 88 SEE / S - FARTENOS E I / O E | E | EE - Lg 2/2 | / 2 2 o and the Six cleleja Ss 5s / 5 / S B8 / 8/3/3 Sig / 8 | 8 2 ejeje and elect and e elect and e e e lR / R | EE and EEEEEE and EE IS 0/8 E / 9/8 / S / S / S o IS | S8 SS Ss S / s Ss ss ss ss S / s S / S [8S | S o SIS 8/0/5 /0/0/.0/.0/.0/,0/2/90/,9/ 2 | 9/2/2222 / 2j8 fF) 3/3/3 3/2 2/3/3353 S / S 2 SS 2 2/2 / S SSS IS SSIS SS SS SS SSIS SB BG SS / 5/9/89 / 89/8 AND 8S / 8/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0 / 0/0 | The à
Ê e E 2
And the E
BE IF gN egTEsa 8a ssSRSEBSESERE ES SS TT SSSS STS SSSTT IT TT TT) o s
E 2 o 8º Ss 2 SB SEaRSSSEBSCSSTTRRTFRESSE Lt H & io | Ss SIS SS als sl a e and SS SS 2 glslgs Big BS REsSSEZSZ2R8s SB | 1% | 68 | 6a | & S | of | cS | cS co 0a | | do | O | O | O | | 1% SS í | 8 | 8 | 8 8/8/8888 SS 8 SS / S | S S / S [S / S SSIS 8 | SIRISR RSS SSIS SS SS SS QS | S | S] S = SIS Sig vg vg sv Tv TT | TVs | Y "T |" | "| Ty
OE E </ 90 / o 2 0/0 / -jo Pk EISISIS SIS SIR SS 2 sI8 / 8 2/5 0/85) </ 0/08 S1 / 2 / o EilaeISIO sá S SB | EIS SE 8 8/88 / 8/5 | £ SP ISIZIE Sl IE SIE 8 / o & / S / 8/9 | E | £ Se << / EI5 SIX IS SSIS S / 0] AND IF <jo | E Ss IS OO ES IRIg [0/0] / E IF <IGI <SO oloj EE SISIS OE E ls o << E 9 / 0E SISIE SS 5/8/8/2 2/28 2 Ss 2 IS E / 5 / 25] S Piel </ SIEIS / eE Die <<): olo E El o / B / 9/0] / 5 SOlE </ o E Flo o Elo 5/2 sa | IklSPIo o Ro lg SI Pi og He o PIER Io | <é | S | & E oo 0/2 SIS And PIE link So So <| E Ss HISIO / O | Silk lo <E / lF OB KH o EI <| k 8 SB 8/2/6523 Ss 2 ESIS Sis e 5/8 sá 3 S / S 5igiFISS a <E 6/8 / 9/5/2/5/2 / 4 / 5/58 3 iPlGlg ES SO EF oo PIE Plo | <[E <6/0 | E rararararaaraEEelelEe They Were assisting 2/0/0/0/0/0 / o RE 888 SS 8] E / S SS - FC Sl eeee EEE 0/90/88 EJEJE / EJE | EE. Lg 2/2/2/2/2/2 o ole eeo | o BE 8/88/88 clelsl el s / lc | s Ss s / s / 5/8 | 6 S8 / 8/8/3 / 3 | S $ 6/8 8/8/8 | S s sa a ss BO) ES) SS o | C FS Egas & [SS dis Sl EE EE EE EEE 8 EEE 3 ISS BlB / a DS> Sa> S / Plalbolal ol i212 £ 88/8/3888 BZ 2 ala aa 2 Ra a ajaia | zs 8/8/8/8/8/8 | 8 anja a | a to H | - & | & tn a to ajsj | a à
It's from
E = s o E 85 z 2 le o o rr ol o | - o = alo lt er e Ss e seas = S E RR IE | SS 2 SS SS SS SS S / 2/2/8/8 STENT TFT SsS Ss SS 5 o o 5 and 5 / s / o o 2
E and o 82 Ss 2 read if s / a and als sl e e ella eje = Ss 8 8/5 S / S o 8 SS Ss 3 / S / S / S / S TSIEISIsZS o RS SR RRESSSS SS eb and ss 5 5 ss 9 alo leo rn ole o = | hello «| o o rj oil o = | a = ooo o o o o lo Ee | = = ls ss sic o Tala 2 [8/8/8/8/8/8/3/2/3 / 3/3 / 3/3/3/3/3/3/3/3/8] | 8 n [8/88 S / S / BS / S SIS 3 S / SS / 3/3/38 / S18 / SIS 3 RSS SRS SS Ss to SS 8 IS S [S | S SS | S | S = SNIS NIN Ts RN: vs and ST ses TN
<C / OI <F / O | O EIrJoOl <| E OjoIr x $ EIEISISIBIE S / S 2/2 / 19/2/3 8/8 / 2/5 S / do ElsIS OB I8S / ol5 2 | É SO SIS e E IRES Seal So 6/8 I / O É DIO HIOI EH OI <| HE rFIOoI <8215/55/52 2/53/82 9/2/2819 2) És Ejs Bo 2 É sig 8/85 E e 2 / EIE So SISIRIZIZS SO eçxRE Ss
SRS SS SP EB ESISIBISS EIS S / S 88 aloe Elk oijolRiío S je SS OE Flo E EQ O Kio | <8 | $ | 5/8/2 | k SIEIE EIS SBS / 2/8 / S Ss | 5/8 & o Kilo <IS $ 82 5/4): SBIS NS SS 2 3/8 2/2/38 8 | E 5 RE EIS SP 5 SIRI So 8 Mix MM XXX | X Wee mMiXmM | XIX E fast EEE RE EC o EEE ES 3 | 5 | 2 5/5/5/5/5/5/5) 5/5/3/2/5/2/2/2] 02 me MN Melim hi Mm Mm NIM Mimi n | à ê E 2
And the Is healthy
T 2 cloln o o - alo TF er link o ale gs ss E 85 8 SIS RS RTSSRESSSSEREB O Ojo jo 19/10 15 jo [5 o io [io [io [io [9 [Ó [19/19 119/1190 119 e x
E e oe if sElrlelo ls = a lglxev es els ga if 5 s / s = = | = | = Jal slN Na NS O SSIS SISIS83 O Ilololo oo 10 6/0 oo oo 6/15/1616 / 10/19 19/10 9 nn Fool mlol lolol = alo llo lao oleo = daQQaQdaNlQNlQaQN OO ooo 0 n / a lo TT Ts 2 [Sl SS SiSS8 / 8/8/8/8/3/3/3/8/8/3 3/2] o S&S ass SS SS 3/38/38 8 S / SS / 318/8 a SSSSSSSSSSSSESSESESSSSS
Er wire E
AND THAT OIK o PISISIS / P SS Drain 58/85/28 5/8/8/2/5/2/5/8 5/2 ep S o lo SE o E | 5 O EEE SD) 9/3 / 8228 5/25/2152 8/0 | É E <É SS 22 E Bee ElAE Ss o SIOI RIO EE EE E RO OE Oo ENE 2 SIS SSPIBSPESERESS S SHIS SP El IE E EIS / 9 RE é | 3 / S | 5 / 8 80 to E EIS S / 8 / S // 8/8 2 | Elolola | ls | £ IE E Solo link> Fr E de | o [O JO </ O | E ISIS Ó BS 2 SP EE ES IP 2/2 8/02 S | Z 2 lee male ie eeeee ie supper 3 letickhkkkietj es E and je $ 5/5 / 5/5 / 5/2 2/2 / 2/2/2/2/2/2/2] 2 X minnilmnjm | Nnlo | io hM | NM jm Mm M | oO a =
E go = 2 o s E TZ
2. and the drain aoo = alo «ojos jo = Sig oo Ss Ss SS sis S / 3 / S / S sis no 19 [O [15 [19 [190] OOOOOOOO o 2 £ 2 o Ss Ss E SsseIREBRSREEBBEEE SRS S STS SS SS SS 6 SS ss o tTloleir / aoo = elvis o roll 2 sas at 8 8/8/8/8/8/8/8 / 8/8 $ | SIRRISS IS RIRSISISSISISS | S 2 SIS SSIS SS SSIS | v | vv vs]
o Zz o o Wu o -lajoig | o river ol o = | angel g / oj o PIS 2 | E P / 2 | RINS AN NS ÍS | S o 2
And So
E Ss <£ 8
S a
E Ss o o = al = - o o v o = o à e
FF x sa IT IS
And the: vs
S 2 If the link a = allele they snes = SIS TF RT SS 5/8 Ss SS o RE Ss o = | aja & Elaleja I had Tv vs ss = 3/28 eojojeo o 8 7 o <c 8 8
S 8 s
It's the
L o 2 = o v 2 nialolo | - / = / olo an o o -lojojo ao v | lo = sISsSTSIQlQ | 9 / O TT TT SST S / SIS | 5 o njNlO vs TITO SNS TT) | TS TT gv j / ojo o 8 a lg 1 & 1 28 E e lInlo ia sm to algiolals e lo EX IB 5 / S 8/0 Mr BS NO o Ss o 6 - o To Inlwojlo violates tr aoo = hello = / ol5 o lo os = z && | O | co | do | hollow O o O 7 oo / 5o / oo / 5/5 / S of QN Ss NS SS SS SS SS NS SOS to TIN RR NOIR RIZSIST AND SSIS lo SS SS SB SSIS S / S SSiSIS / SB SS | 8 2 | j & / S / S | 8 | 8 | S / 8 | S / S S / S e and o o o o o
Z o o à no olo = alo Ts o rj o o slalojx / lo / oj / rn n INS N / S | S / S / S / S it o jo iv and SS ss o 2
It's So AND
S <2
S 2
E Ss 7
O o oo ajl = - o Ec o Es o 2 = zs8 f 2 E & as o - 88
S E ale and ale and gel g = lolol nlajojl o | o = SC & Sjo o jo o Sol nm Tia So = NS ON O E o jo / 6/6 6/6 / o / ojól = a Na 6 o 6 0 jo o o 4 o = 8 8 = Ss õ
And o o o o
And o o o 2 lolol e e = | a o «o Se nel = | 2 adj jo tr vo] 3 SS 8 FT SS SS S g IS Z | SN 22 S / S FS | S o SS 6/8 6 6 6 O o 6 = | NJ Ss to aj O SO are the
E & 2 - 8 and alrio ol eir = | w / o Nico o nlo / o x Tv Eros STS BD o v come jo Rr Ro o s / a lo lg n / o o = lal = lianjo | o ro o o = | a Z [SS SSIS S / S = SR ess Ns NR E o oo Bla eeeoe o 5 S / SS / S o 5/2 jo 2 TF TT Ts E Sis gs w / o0 / 0/0 / 0 / 0/0 0/0 0/09/90 O o SS S / SS / SS / S Sala ae ssa and Qj a eo 2 [els eeeooeo vv sv vv | | «| | -) <o Zz o o us e siajol «le lo nr joajlo si iajo o DX o | Ej) T bio l '/ Sjój o 6/6 o o oo Ss o 2
It's the
And it's £ 2 a THE
And ooovoooo Es o “oas ss is 22 And o ia o - v 8 o 2 Sl a = alle e e els esc aj ese = So $$ BH S / '6 S6 / 6 / o / ooo 0/0 o SERES EO TT) And els sv | SS E sv Ss s Ti e el os 3 7 o <€
S 8 Ss
It's the
E o - = o o 2 [year o a oiglele re = Te e r / o lv link CE PAGINCIRADIRADIDIDRAR ARARAS AD AD and joio CENCIRIARANANARENRARERERADRADA | 7 Titles o o “= | = 8 Ss with lola alo o | no o e 7 Tinjolo | x & mi 5/0 / 0/0 / 5/0 / 0 w o E) Ss Oo or 9 sas those scssSsssSssSS | sss8 z | 08 | | o a am me os 0/0/0/0/2/9 / 9/9 9 08 | & | 0a | do | co | do | co | co | co | co | co co co o wo S / S S / S o Sl o lo o ole o else Ss o Ss iSIelRIRIRISIRIAIS 3 ae SS Sa als SS Ss Ss SS | S | SS SS 2 [SSSSSS SS Rs SS Si Sis SS "
o = E) uu ol-lnNlo gioj o - / o / o minlm | glol o nr / aj o o WIN NIN SN Ne NS NS O | co | co | cO | poop | 00 | co | co jo 2 2 = s AND s AND
S õ &
E õ 3 8 8 ojololo o 8 o 8 Ss Z
It's 53
FS 2
TE 2 e 88 os 2 Sl ol wlol- he ole = a xlelevis gs as es 2 se elgis e 2 Sia SS RR a SR SB 9/8/8 3 E NTE SRS STEsS Ss ss ss S / S is S / S Ss o 3 2 3 € 8 8
S 3 8
It is 2 8 and o. = o 8 o 2 nlelal = la / lale = allele or he ale + | = do [15 wo oc o o Sis SS Soo a = = TITE v TS gv / o o / 9/9 / | / o ooo o on o o 8 ã = 8 lo o leleialv = allele a and als Ss o = O jo | jo o nr / 5O O 50 / O / 0/5 / o NNW O | elololk | o laolei = Ialelzolelejelole <wing Zz SS Ss o jolóo le les E es sis ss s / a to SS / ISIS 8 Sa as / a / aas / 3/3/0/98/2/9] / S n [S / S 8 SS SS SSB SS assistance SS SS SSS 8 IRS | RIRRRSIS IS SR RS SS] SS SR S [S | S = Tg E vv vv Tv | ss v | "|" | Y | Y | Y | Tv v | Y o 2 [) o alo vio o ir aj o ul riajo o nn Oo ojesisilcior rosie ole o o 5 | o o so oO = e ejelelelejelel »2
And the
E ã & 2 ã & s õ 8 $ o z 8 9 8 IT IS IT IS
S ss "». 2 8 + 2 - only Healthy 2 ss e = 88 Ss LAUGH SNESSsSS8ZS 58 49 E | a | a9 [a [0 [4] [o So oO / o 5 Lars | ian quo fas dio fis s
F 8 <T
S s
Ê 8 8
É e 4 o 2 = o 8 o or eo o = la go 1 | choir flo tr elo = mi == VN NiNlN NI 0 | 6 Ai Minimo o oO oo 109 [19 | 19 19 | O oo 19 jo oo fo (io phyto phyto 2 8 e. 2 & 2 8 e Nm 0 O oo hello oro FT / o - Ex TO [O Wo = olFi vo oe vv o link r / lo solo = aim gt and rj aj o jo | ajo o 2 g & NaRS Saes SsSEsSTSRT
SN SSSSSSSSSSSSSSE SS o oSso o o / o S / S jo jolSo o / 0/0/0 O OR RIO 2 ISISRIRIR GO RSS SRS SS SS SISTSISÕS = Tl ss TT TS Tv viT | vv Tv "| ss Tv vo o = o 3 she and je roll o rooms E SR 2 2 = 2/2 SS SS Ss o elejeleis ee ee e se e he a 2
And Ss
E & <£ 2 & a
E Ss 8 o v o o o o ki) o s
FAN
And is.
FROM the grandpa. q ENTPIPIPSPNDINAPICICIPINIPIEIr = BS hello a a a ls5 / 0/0/3/8 6 in 6/16/66 / o / o Si o o
S a o = o 8 Ss 8 Ss
E o = os = o ke) and elrlalo rio ol o = alo lv / o | o 3 | RSSSEFSSS ss 23/28 oo 1 [19 o [o 19 [19 [19/19 [19 119 [19/19 o & > s AND F
B e elect to have o or oo * INSS Ss Sb S o SS O EN 2 lelr / lal laio rj alo ve on oez [SSIS S | S / 5S 8 8 3 / S / 8 SB 8 SiS / 8/3 S / SS / S 8/8 / 5/8/5/5 on S / O / 0/0/0/0/0/0/0 / 0/0 / 0/0 / S 3 la lR SS SR AS S / S SS - SESENSSASANANANASA SANA SANA NAS o Po 2 oo <olalelgle os <Ss oo Pi <j | 5 S | S Link E sf s EE S SI5 / SEEES / 5S link SS ERES o oe eess <SlolOIõIE O </ lelaitis ee se 2 SE "<IF SI Plolólgio o Õõ Ce <| E Old 8 E olo SIP 8 SIS | E / = / g SlESS 8 - Ss OjE Ses <E £ $) s“ EE É | ds ES SRS EE Ss SEE 3 </ 0 / E and the FI Link <XIO | </ E> SEE lolo 2 / S Po HE SE R | E | E s </ S / 0/0 0/0 EIS og So EE <Ss o 0 / 0 E 0/0 0 HO KO E Ojo õ 2 SIBSSIE | O £ 05 Ss SE SI5S] 5 s | 8 3 | [E8ZSSEEA SSB A Ss Follow 8 xs 285 818/85 8/5 2/28/28 = HO O 0 <E <PF <E 0/0 / It's 2/6
S a 8 o É> o Y 83) | - 3 2 | | = <s 8th olT = e and he is ala jaja | a | aaa S g / 8 E E E E E E E SISS [S SSIS: the Qla-mis | s | Ss sjS | S | S / | S | SS / SS / S | S | S | S / S | SO PS E IE EEEEEEEEEE 2 2 2/2 É = E oo mw OI E if E z |: 2 93 2 Ol E ug $ js E Ss will QE WO j— E slo e 83 altr / e oe = link = oo | ala 8 Ss 2lolgin = o N / S 8 8 S / S 8 SS RE / 88 = Rg 3 ss g / S / 0d SS R RS SNS RS g E ojo o = | o e ele el eiejelejls aa: a | ao
E o 8/2 2 2: o à = lo I / O 8 ojis v o | g 8 8 e | - Only her 2/8 SB EINS SF SISBIS | E & 2/8 SIS 8 SR RISITIS RS SR o 2 / S and AS RB 8 PS SR 2 S 2 RS SISTAR = uo «and Zlolbolzalese eselele cale lee S 3 28 / 88 8/8 8 SIS 8 SS ss ss s / 5 / S 2 SloS8 8 3B 88/88/88 8 8 / S / 8/8/8/8 S Ss sas SS SS SS SS SS SSSSSS S 8 OE SS SS SS STS SS SS TS STS SS o - <jOo r Ri </ o S / s EE behold SI Blá is sigIs / a 8 o <Io Fislo ooo Sic rj o E 2/0 / PIE o ls 9ó ES oo Elgg $ a BEE Ss o I / O FZ ss ES So Ole ICIOIOSIRIS EISIOI <SE oj <ok õ HAEBRBAHOHHE $ | 3 | / 2 | 8 215 S <o Es <a R5sESRS Ojo - the Ss oI £ $ / o | o 9 < IS O o <jOo Ooj <o O | O 23 SIS S / s 2/18 2/5/5128 8/12 SE
SBB RERS SSESSSES SS IF o </ - / o E 8/83 5 3 / S 0/8/5/5] 8 SI2 E 8/95 EEISIEIS 2/22/88 nI <Oro o << JO FI <LIA x Hello
E <Ss o 9 ala o a a e ale e e e aj aj o SS E SR LAUGHING RR RIPI RS | SSIS: Bm s | S | SsiS | S S / S | S | S / SiS | S / S / 8S [8 / S / 8SiS PIE E E E E E E 2 2 2 E E E E 2 E É Db - 2 THE AND s
I Ss
S Ss &
It's s AND
B HEINPTNNDINEIRAArINDNEIFICIrIra Ss BIZ 2/28 s / S SS SS SS PSB 8] o 2 S SS be ssSSsS Ss STS ST DS SsST STS SS Ss Sos SS SST e e s
E Ss à a o s
And 3 seis 8 SiS PS 8 BIS SIS RBS Z / 8S / S Ss gs SIS Sina and BS o ls ae Sa ee SIS 8 = S / S TR 8 ss S / s S / S 6/6 RR Slwlo lo = ale x link tn link o = alo go ZM MN O o co À o Ho oo 0/0/0990 / 0/9> S / s 5/8/8/8/8/8/3/3/8/3 / 3/8/2/2/38/3 / S vis SS Ss SBIS / 8 SiS Ss S / S SS 8/3 / 8S
DIS RSS SSIS SS SISISIS SIS RS o = oo wv / o river ol oi = angel lv oo Mr 0 / oo = jajo mu | RJS | S RIS / 8 9 9 8/3/8989 Ss oo TT E 3 ao & Ss - = <£
Z õ Fl = Ss o v o o & 8 s
It's the
S - o
And the & <: Ê 238 o vo Fr Tolo + lo 10 o = at the top o EX TIBS SSPRPBS ST / 8 / S / 2 / = / 8/6 / "- Now scT es SS Ss ss ass 2 o = SS gr 2 SIR IN STRIS TNT SN AN SNS 0 9 OOE) 9 8
S s Ss
E o o e <Ss 7 Bo en = alo tn alo o ojo | nr dude io If BTISS 2/8 SS SIR SS els T os = o CN o jo o | = = / O | vo 0/0 / 0 / O = O lr OX Sex P2PRS | S SS SS SS SN only je e = o s
AS O |
E & Ss and jo elle le le ER To Telas T [e
E Sõ ç No sslslez sis se sex alert ejelnie Ss iZz O Ooo o ol ooo or DnRIiNIE IN eee> S / S S&S 8 8/8 8/8 / 5 / SS / so ss ss gs lo [BS SS SS S / S SS SS SIS S818SIS So | Nis | S / a Ss SS SS SS SSTISSS | S | S HI = TFT E Tv vs | v | T Tv | YiT | | v | YT Y | vv o <a o TE Ng 2 Ss S8 AND BS5IS8 SIS> »FT TT g / o / o o 5/8 / 9j o o o jo a 2 o s
And the
E Do
E Ss Ss v o & Ss Ss & o - o & & SC
E 'g 2 8 o Txrcio = alo ale - ol and lt link | o 3X IIS 2 BIS So E Ss Tx 2 jo az 3/8 8 olw Sm a o rj o e = alo S / S NS link S 8 2/8 8 SS if e ee e and o o o 9 8
S 8 & t o Ec) o s
E Ss F Blol o = alo lv o je la lo = e e e </ eo e ale a sis and RS ola roo TS SS o sirio Dor | o a NaN Oo Oo lan O olo Sms SSBs Ss 6 / Se er ee o O o o AND
And s
And ko 9 x read islealele & Res = "238 zZ [LIS FS S 83 3/8 SS SS os / 2/2/2/3 lg 8/8 / 3/3/3/8/5/2/3 / 3/8/2/3/9 / $ | S BSS SS BS Ss Ss ses ss ss 7 QdlsQQ Qd SS SS IS SS | O = TT ss sv TS vv vi vv "| Y T s
. 131/232 Due to the short length of human transthyretin mRNA, a second set of primers was designed differently from the first set of primers, RTS1396, to avoid amplicon oligonucleotides. The antisense oligonucleotides were also tested for their effects on transthyretin mRNA in vitro using the new set of human primers RTS3029 (direct sequence CTTGCTGGACTGGTATTTGTGTCT, designated here as SEQ ID NO: 161, reverse sequence AGAACTTTGACCAT- CAG, here designated as SEQ ID NO: 162; probe sequence CCCTACGGGCACCGGTGAATCCOX, designated here as SEQ ID NO: 163). HepG2 cells cultured at a density of 10,000 cells per well were transfected using the lipofectin reagent with 50 nM antisense oligonucleotide. After a treatment period of about 24 hours, RNA was isolated from the cells and the levels of transthyretin MRNA were measured by quantitative real-time PCR. The transthyretin MRNA levels were adjusted according to the total RNA content, 7 measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition, compared to untreated control cells. The results are shown in Table 3 as a percentage of inhibition of the set of control cells in PBS. Table3 Inhibition of human transthyretin mRNA levels by chimeric antisense oligonucleotides containing the MOE 5-10-5 flanks and the deoxy interval with the RTS3029 primer set
ISIS NO ao [5042866 - Jeca lo 304288 45
. 132/232 Region% inhibition 304289 = coding 304290 coding> - and 304291 coding- terminating codon 304292 coding- terminating codon 10 304293 coding- terminating codon 304294 terminating codon-3 'UTR 304296 exon 4 exon 4 2 304299 exon 4 the exon4 = 52
PTE 304302 exon 4 - - exon 4 - * exon 4 - 62 304307 exon4 Y6 304308 exon 4 163 "304309 exon 4 75 - 304311 exon 4 81
E The coding is coding 19 In coding 6 420876 20: coding 420880 36
.: 133/232 coding 10 coding 27 coding 13 coding 28 coding coding 39 coding 37 coding 2 º. coding 21 coding. coding is coding coding o: coding 8: [420898 - | codifying coding coding-- the terminating codon-3'UTR terminating codon-3'UTR terminating codon-3'UTR 420902 terminating codon-3'UTR: 420904 terminating codon-3'UTR [420007 - | -codôndeteminação-suTR jo |
: 134/232 420011 120912 ——— | 3auTR 420913 3'UTR - 81 la20014 - - [auTR 88 420916 3UTR 54 420918 SUIR 43 la20021 - —laurr 65 420922 larg 6
420924. SUIR 9
: 420925 3UTR 7 420927 3'UTR - S7 420928 3UTR 51 420929 3UTR 46 420930 3UTR 420931 3SUTR - 420932 3UTR 6 420933 48 420940 3UTR
: 135/232 Region 3UTR | ESSPR EST FP PEC a AAA a a O 3UTR BO ===. 420948 3UTR 73 3UTR 3UTR 3UTR 420953 3UTR 71 e r 420954 3UTR 67 3UTR 73 3UTR 3UTR 420959 3UTR exon1-intron1: 420962 intron1 And intron1 420068 = limon o 420069 mon la
- 136/232 Region% inhibition inton2 and inton2 420974 420975 9 420976 intron2 21 and intron2 un intron2 37 intron2 Intron 2-exon 3 16 420981 intron3 Do 420983 Intron3 of 420984 Intron3 o - 420985tr BB 420989 Íntron3 - lo intron3 and 420992 intron3 o intron3 a Íntron3 Bb 420995 Based on the inhibition results using the new set of primers RTS3029, antisense oligonucleotides that present 50% or more inhibition of transthyretin mRNA were selected for further studies .
Example 2: Anti-sense inhibition of human transthyretin in HepG2 cells by microwalk-designed oligonucleotides
- 137/232 Additional gapmers were designed based on the gapmers shown in Table 3 that demonstrated at least 50% inhibition. These gapmers were designed by creating gapmers displaced slightly downstream and upstream (ie "microwalk") from the original gapmers in Table 3. Gapmers were also created with various motives, for example, 5-10 -5 MOE, 3-14-3 MOE, 2-13-5 MOE, and 4-11-5 MOE motives. These gapmers were tested in vitro. HepG2 cells grown at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM of the antisense oligonucleotide. After a treatment period of about 24 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer set RTS3029 was used to measure transthyretin mMRNA levels. The transthyretin MRNA levels were adjusted according to the total RNA content, - 15 measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition, compared to untreated control cells.
The results are shown in Table 4. The chimeric antisense oligonucleotides in Table 4 were designed as 5-10-5, 3-14-3 MOE, 2-13-5 MOE or 4-11-5 MOE gapmers. The gapmers designated with an asterisk (*) in Table 4 are the original gapmers from which the gapmers, ISIS 425650-425763, were designed using the microwalk. The 5-10-5 gapmers are 20 nucleotides long, where the central opening segment is composed of ten 2'-deoxynucleotides and is flanked on both sides (in the 5 'and 3' directions) by the flanks that comprise five nucleotides each an. Gapers 3-14-3 are 20 nucleotides in length, where the central opening segment is composed of fourteen 2'-deoxynucleotides and is flanked on both sides (in the 5 'and 3' directions) by the flanks that comprise three nucleotides each. The 2-13-5 gapmers are 20 nucleotides long, where the central opening segment is composed of thirteen 2'-deoxynucleotides and is flanked in the 5 'and 3' directions by wings comprising two and five nucleotides respectively. The gapmers
. 138/232 4-11-5 are 20 nucleotides long, where the central opening segment is composed of eleven 2'-deoxynucleotides and is flanked in the 5 'and 3' directions by flanks comprising four and five nucleotides respectively. For each of the motifs (5-10-5, 3-14-3, 2-13-5 and 4-11-5), each nucleotide in the 5 'flank segment and each nucleotide in the 3' flank segment has a MOE 2 'modification. Internucleoside bonds across each gapmer are phosphorothioate bonds (P = S). All cytidine residues along each gapmer are 5-methylcytidines. The "target start site" indicates the outermost 5 'nucleotide into which the gapmer is targeted. The "final target site" indicates the outermost 3 'nucleotide into which the gapmer is directed. Each gapmer listed in table 4 is directed to the target region comprising nucleobases 481-619 of SEQ ID NO: 1 (GENBANK NM 000371.2 accession number). As shown in Table 4, several of the gapmers have .- 15 ram at least 50% inhibition, including ISIS numbers: 304296, 425655, 425695, 425735, 425649, 425656, 425696, 425736, 420912, Í 425657, 425697, 425737, 420913, 425658, 425698, 425738, 420914, 425659, 425699, 425739, 304299, 425660, 425700, 425740, 420915, 420916, 425662, 425702, 420919, 425703, 420921, 425663, 420920, 425664 425705, 425743, 420922, 425666, 425706, 420923, 420937, 420944, 425669, 425709, 425746, 425710, 425711, 425747, 420948, 425712, 425748, 425673, 425713, 425725, 425, 725, 425, 725, 425, 725 425676, 425716, 425752, 420949, 425677, 425717, 425753, 420950, 4256/78, 425718, 425754, 420951, 425679, 425719, 425755, 420952, 425680, 425720, 425757, 420954, 425756, 42095 425722, 425758, 420955, 425759, 425724, 425760, 425762, 304310, 425729, 425764, 425653, 425690, 425730, 425765, 304311, 425691, 425731, 425766, 304365, 425694, 425693, 425694 425733, 425768, 304313, 425734, and
425769. Several of the gapmers showed at least 60% inhibition, including ISIS numbers: 304296, 425655, 425695, 425735, 425649,
. 139/232 425656, 425696, 425736, 420912, 425657, 425697, 425737, 420913, 425658, 425698, 425738, 420914, 425659, 425739, 304299, 425740, 420915, 425702, 420919, 4209, 4209, 4209 , 425706, 420923, 425746, 425711, 425747, 420948, 425712, 425748, 425651, 425715, 425751, 304309, 425716, 425752, 425677, 425717, 425753, 420950, 425718, 4257, 425, 725, 425, 725, 425, 725 , 425680, 425720, 420953, 425681, 425721, 425757, 420954, 425722, 425758, 420955, 425724, 425760, 425764, 425653, 425690, 425730, 425765, 304311, 425691, 4257, 4257, 4257, 4257, 4257, 4257 , 425654,425693, 425733, 304313, and 425769. Several of the gapmers exhibited at least 70% inhibition, including ISIS numbers: 304296, 425655, 425695, 425735, 425649, 425656, 425696, 425736, 420912, 425657, 425737 420913, 425738, 420914, 425659, 304299, 420915, 420920, 425742, 425712, 425748,: 15 425716, 425754, 420951, 425679, 425719, 425755, 425680, 425721, 425757, 425725, 425725, 425725, 425725 0, 425765, 304311, 425691, 425731, 425766, 304312, 425767, 425693, and 304313. Several of the gapmers showed at least 80% inhibition, including the ISIS numbers: 304296, 425655, 425695, 425736, 420913, 425659, 304299 , 420915, 425716, 425754, 425719, 425757, 425765, and
425767. Several of the gapmers had at least 85% inhibition, including the ISIS numbers: 420913, 425716, 425754, and 425719. One gapmer, ISIS 425719, had 90% inhibition.
o o s Zz IS S 9 Ss g oo link WI a a a e e e) nn nn) co) co 2 HW Sds NTS E ec nn RR RSRS ic) À o o 2 o
S E E s ã e> o x Ss Fa ad a to E els 3 - So 2 S 21 e) he is he and he is he Tesla sia = 2 2 = <= 3 2 he is also saddle
Z 8 o ol oo << x Z <| <| <| <| O) o) 6) 6) 8/3 6 o Pe So oo O o oo o0ooerrreeaaa s OO oo EEEE & <<< 5 Ss HE EEE ol ol ol ol ol ol ol ol oooo ol <<< << 0 0 0 0 0/06 << aa 8 SSSoS SOS er T o os olo ooo rere O Ol Ol Ol EEE) E s 61555 S / S 8/9) 2 << O ol ol o ol à is ooooo ó / à o < <<<< o6) 0 o oe: Ss xi << x Only Ss S If Er and << 2 2) are oorFrrErFsSsSsSsos2 | 3 | E oo oo << <a 8 EEEF E SS 8 5) 2 <= <F E ss Clos SPeRRABeCe a * 3/32 8 85 5 58/5/9/5/9/868 E $ / 8 0 0 60 000 0o0ooooorr-r Po ee -> = pc Se = s <|
SI E | AND
ENXNIG 2 O 8 os 2 e == = = a Is 38 8 53 5353323 aRRRASRASASA 2 8/98 | S&S) 8/8/8 / 8/5) 5 58) 58) 8 SS o 8 8 | tv o) And I saw
CSS Ss 2 E - E sssSsssassasssss = Ze ss Ss 3 Ss) es) << 5) o o 6 o - 7 Álo Seal o ee ee Sn ns es | a sl 8 8 8 2 $ 88385 58 S Ss: | If) rr e and nr S o and rr Ss Ss 2 o | as 8 8 5 Ss Ss Ss 5 SS 2 Ss) Ss | à E) 8 à ds 8 a a a SS ala a SS O fe mL Los sa) ND] SDS) sw Os
O | = ie) W | oo co oi ol o o o o) o) o! o mex OL RE RR RR AR a a a a o o co) co col Om a 38
E 3 =) el el el el al al al es ess ass 2/5) 2 e ss S 28 Ss Ss S s 5 8 5/8 | o) ol e] ee agr er tel eo] el ei ie rar ei e] SS Ze bone saçzessijge sd. = aee ló la seo oa solo only 6a OL O eis eee AOL O Oo ooooe ENS OS ss S / S 5/58/89 8/8/8188) $ </ <(OOO od o oo ooo ooH HT HH SI S / O oo Oo o oo pray O is 8 he they Ss ss 222 &: FEEEERBERERERERERRER 4 É Si SS Ss EEE << É SOS OO Ee RE aa << the duo OOE HE EE << << << 0 0d oo <a << << O. EH E sas ae qo o oo <ddadsaearrro Ss ass oogassasgsrcjrrre sas egRAUSASEHEEOÃOs ol o ol E <qrleerreõ OOOOO, O! OI O SEE S5S 9/8 SS 8 Ooo rFEEs SE E wings oeednaAenk o 31 81 a ol e olErFFEFSS oo eee E If EeERHF SO oO o olmMPeAdeoosos e 8 & AND
E 2> 8 2 x) x) ol el io) so ol ol mn en o o and o - dass ass ss sssssaasass O o o) 19] 159) 15) io) o 10) | and to) to 4o / ao ao to
The 2
E 2 8 2 es - 1 sl ns) | cof sl el ml o q Ss ss: s esssala Ss as E OI o aa o O) 5) 6) 15) 15) o) o o o) to ml ol E to o ol 8 o) o o els = = elala 2 $ | S) 3) S | S) SS] 8 SS to 8 2) | 3 SS) s SS SS) 2 8] S / S! S | 2/8] SS] SS] SL SS IS TS SS OoSSTS STS TFT sTsSTs o | o o a uu ni | 3 83 8 WS Ss Ss wS Ss 8 SS o 8 2 = x 8 RE 5 8 ER 8 8 3/8 3/8 8 388 2) sl 2 e se] e e e e e] e e e es e Sl 2 2 es e to her series Ss sz SS WS | aa A al a to o a cs as! | el ss! and as = ODIN: E | 3 39299 8 asa 22 Add E goo Sosa ASAADEHNAAs ss aasa <dffcrfs 6 oo SS EE EFE Er OO Oo o 0 0 o E Sol oo EE É É Ss 5) 5 ooo Re eFRS SS O Oo E EL ERROR lol oo OER « | . al ol HHHr ooo oHr er ooo: E / O) 0) 0 51 5151 Bb S 2 28 oO << <c 85 553555 2222 Adddsgsss 2 8 8 2 2 2 2/9 9 9 9 3 3 3 2/3 34 3 212) SS ss 23 2/2 3/3 3/3 8/8 85S er. 0/0 0 00 0 o or HEHE << 8 E = 6 ooo 0oocoPPFPFRZ SO o 8 & IT IS
E $ o 8 = | sl al e BR a a a a SB 8 8 as sa O 5) 6) o] o] o] ao) o] o] o] o) o] o] ro] | | to o o 2
E 2 8 2 laws s e he eeeerssa 6) Ss Ss) SS Ss Ss Ss Ss Ss Ss Ss Ss E Ss Ss o = q o 1 8) S / S 3 to SS 8 8 SS 8 ST Ss SS 8 | 8) & i 8) Sl SS) 8) 2) Ss Ss and SS ss S 4) 4) SS to RSS 2 to SIS SS SDS SS SS TS SS TT TS 3TS ST Ts.
o = 9 False aa 2 aoe al ala oee € / e SS PS SS PQg | s ess = s = s = sss = s = o 8 Ss = x 5) 8 SS to 8/8 8) 3S & s sw RT 2 ) sl 2 ee el ee el e ss] eeeeee 23 ser édesnaessdssssdess Zola and the al and o allele of the so ôla sd E) EE EH) ooo F 3 88S3SHaddAEFASSSO eee << al: BS 56 EE EE | 6 o o 1 O) O! OOEEE] and ee EO O RE RR AO OOO: OOOO Ol 0/00 / 0/0/0 / <«<<" OL OO O EK REA << xoo oro EE EK E EK E oooo ooo oo o ooo ax 2 2 2 <<< <ooo: Er doço0dso: El E 6/5 6 o al & OO! O) O) E) E o) O o re O Aro O so O o O OO / 0 o 0 0 0o0o0o00o0o IF BEASTS ooosrFrodoooooxqa <a <2) 2 2 2 6 5 9 5 68 68 8 5 5 5 5 Pee is 6 6 0d ooo << <rrFrFr <aas o 8 & AND
E s o 8 2 wing al o o e = = = a eos a ss dB) BS 8 6 8 6 8 o o Ss os ss) o) o) o | = |
FE o 8 dao so = = a as a ss ss and ess 6) Ss 8) 8 3) 3 ss Ss a a to 3 3) 3/3) 3/33 z o o o s | and 2 3 she and FS eetoos Tasso 8 SS to SR SS Ss 5 Ss Ts E SST S $ SS] 48) 4/8 8/98/88 Ss 88 8SSSS SS SS STS SS ss SS> 7SSSF SS 7 STS
Z o o ne = = It is o o and TE EE ISS sos: Ol O! O O O e e el el e el el A a a e | O S &
E z = m) e) «| e) el eo a NT ra E) o NI NvEN) vv Oo Wo o | o oO o) o 2) | ml 2 e e] e e e e] e e e e e e 2 72 dd sos cattle = o ala seo ola seô ol 6 oa + o HEHE ol o o S | 6/69/59 6 ao e EE EE SS SS 22 O OL OL OK KIKI KI O ol ol o! <<! <<< o o E) EI E EL ol ol ol o) </ <<) </ 6] 6 6 à o o 0 Ol 0) ol <<) <) <| O O) O 0 0 0 0 or rt <<) | <| 4 O) O O 2 0 0/0 / 0 KH KH HK HK oO o: 3 o) o co E E EL E o) o) ol ol o! Ol Ol o o) 6) 0! ol ol o Ol! O! OO 0 00H HE O / OOO KH KH KH HH OO Bee o ln ERA oo ol 6 E r So) Solo HE HH RH o lo oo HE HE HH oo Mons eos now Eeoro o oe 18 815 8 2 22 2 2315/2151 5 / 5 9/5 8 S e; S | <) <) <| <| 5) 5) 5) o o o o oe E) E SS) SS IF me EEE SEE 3 E E E E << << E) E << << O <<| E E E ES << E E EE sr FAS ARTS ms eq if RRrEAR o s
S s
E 2 o ko) 2 o) io) olio Fr o o o o ns) o =) S / s 8 Ss FR 8 | $ / & | &) & | o) to O | 6 6) 6) o O 1) 1) ao) oooo io oo 2 seo 2 SS 8 SS TES NR RR RS Sssss o BL BISA SAS SS 5) 55 5 6 5 Ss e go sssasegsge ss Sega: FS ssSISSIIRSOSSTsSsoESs 238 R2SSASSSSSSS3 <2SSSA o SS STTSTTITTSTSSS SST o SST STS
O) =) a Sl el e) o) e e) o een nn) e) 2) o) À El El E = = es = sf Ts ss == o
It's the
E = E) LR RP) o | Rs ES Ss E Ss 2 / | ee oe e er Soo ee eo era Saes sc ioHAsdoqidadenNclzdaà | Alsz = A e el elal e lol o sol a a als oo << «<< <dlx oo ça ol ol Herr Z | | SS 6 o o o PPP SS 655 3 3 o o 0 OK K HK K o o o o o o o Ol O E EL E E) o) o! 0! 6/6/6606 / 65 6/06 EE) o) ol ol 6/6/6060 6 65 65 6 EE Fr ooo so oooooHHEHrFrHKHo seo: OOO 6th ol olKE KR EK Ol ooo KH HK HE 6 O) EEEE ol ol 0 / 0 HK KKK ol o oo E El ol o) o) ol El] EL ELO o! o) o! HE HE HE o) AND HE HE O! ol o) o) E E | El El o / o / 61 o: SS ol o ol olN Eh NFSCSPASoEEEE eAassssSePeeeececorFcrez a ss OsmrreceEe EL E << << SEWAGE BAG] TsESRNRE EE 3 A AAFFANNSISISSSS 8) El E E ES O | O o o E EL E E 3 EEE E O O O Or HH nr << << «<x o o
And £
E 2 o ko 2 ml ol ol o o o = | = = =) al wing 2) à) S | SS & | o) & S / S) 5/59 2) 2olo O o o o o o o O Oo o) O) O O) O) O) o <= o v o = | RR) 8 8 3 3) s 2 ss Ss) sS Ss S 38 38 6) O) 6 oo 5 an] a) ao oo) ao) o to to o o = a so - mg sgASSgSe SRS ss: nm e / 38 Ss ne 3 es Ts e 3 es = = as os rw SS SS <sSa <2S RS SSSSSSSS ST SST STS7T TST STS TT
= the I 2 os; o o o o o o - -— <= a qa a a o o o ot oTs Ss ass oaasassossceso 2nd 8 AND
E xs = 8 8 TST T8 5 27 T 2 | e) e e e e el el el el] el e e e] ss ae 7AAATADATSHS HASTA welds and her seal ol dll ol al se o! a o E E ooo 3) 8 818 8 8/8 8/8 Alelsis Ss 5 88 Hello! O! o E EL EL E o! O! O! E EL HE OL o Oo er cel ePloo o! ole EE o ooo Hr E 51 o 5 65 e BE Re o oo E RE 2 Oo 2 RIRIRIO 5 oo 5 E 5 0/0 oo FF - ol o Sis E Es E oo = E) E 555/58 2 2 9 2 8 E ss: ”Per <| << El É É E E E E << << E E E E E E G E ART EIEJ E EL! S | SE EL GS and el e | E E HE mo So eee 8 El el E 66 o E E RE SS Ss S | E E E 6 6 6 6 mg & << ss So oooHr /] uothnodIses 31 the SE Z & 4 4 4 o 3 o e e e e 3) E) 2 2) 2 5 8 8 3 0 0 0 <<< os o 8 s AND
E 2
And 2 lo oo + ss! «| «| o | nl NON = | 8 8/8 8 3 3 3 3 8 Ss Ss ON O O O Oo o o o o o o o o o o es E |
B 2 = | x] 2 oil e mm e els =) 3 32/3/8/83 8 | 5 5) 5) 8 8 3 o DO o o o o) o [e] O) 5) o ao o] o] 1 »bd to | o rm co sl ss 3832883 38 el 8 e NR S o rr rm à o 5 Ss o mr Nr Ss o 3SSsSsSSSSSSS2SSSSSSS o SST STS sSgS STS "SS ss TS Ss ss o
Z o o ma SS as eee ss sses: o s IT IS
E x 8/29 8 4 5 8 = 5 858 E RR gl he) eeee or aeeee el e Sa es 3 odds osgssdossaAçósdáidieo E sos olada dolo ada ad ad o o ss ol o EE and 51505 5 Bl e them AS EE FEEEE O! EEE RE 0/00/00 E EINE E) E o) o o ol o E 5 5 o BEINGS SSSS82SS:: Am E EEESE SS SS rl--: EE ERARFEEFREZZS2333323: s EL HE EE) O) o) od od ooxs <- 9/0 0/0 aeooos << << <o: O) oo olE RE EE </ </ << oo 060 <PIT TE SAI oooSosas so 8 = | | <<< <| <<< o o o oFE e) SS 6 oo OS s | o o o o o o PER EEE EE 3/89 6 0 90333 SHEHrFESS El o 21 | 3) 3 So <<) RS 55/5/5883 8 868 to ed essososSssSsoooov0 | soooêo rr o
S & € õ 2 o 6 2 mm) ol ol o o fo «| and e «| o o o o = | 5) 8 8 3 3 | Z Z | 2/2/2122 n / oO) oO o o oO o O O) O) Oo) Oo o) o) o 2 3
E o = f in al ol el e | o) ol el el el rs = | S / S 3/8) 8) & | | & S) à) S | a) S) Sl Ojo o 1/40) to o 6) oO o io io o o o o o - iflccdasdaasdaddl 2 SB NS e e Rs RS a e ns | e) e) Ss] Ss) & S&S 5) S | 6) ol o] o) o) ol ol | o) o] o) 6) 6) o) o) Ss 8 SERRA AL SSL SL SS SRS QL SESC S Teresa SC v We O ST CNT W "" ws:
o = [| 2 3 8 8 302 8 8 8 elects 6 to Ss SsSsssTc = ce msnçeX == o 8 if Hs Z <| «| hi hi elis el | ol el ol el eax E 2 2 <8 5) 8 23) 2 8 8 RS 8 2 le eeee el e] eeee] eea Ses oasnesseossasdesez 2 ó al al al seal al so 6 ada + cdegggggsssseesge E HE eee ol EEE RS gs ss 6) 6 IF EEE << ss ER E + 2 << Ooo $ | $ | 2/81 3 3 8 8 8 o 2 228 "3 o) 6 à 0 oo <<<<6 ooo link hello Jd <5 oo xx Ad a <coconuts <1xosous S / S o <<<<ooo or E - Rx x Only o5860 EEE: BB and FHEEE El 5/6655 BEINGS E | E) 6/5) ol 6 / 8/90 oo 2 He ae oo and cleo o cdos & s "/ 6a o Ss o 22 ooe Ss Rh 818 8122 8 9/55/55 2/29/88 3) e) PR) 6 5 6 w) 2 2 22 222 o 8 & =
E 2
O 8 = 2) el E E ss 2) 2/2 2/2 2 2 2 o O O o o o o do o o o o o o o 2
And the 8 Sb 2! 2 gs ee: = 5 5 8/8 s 3 o 8/8 38 E E Aiddddadaddddas a; oo Ss ooe 5 ooo = ooo 8) 2) </ g / S / 2 g) e] es e al e) rs S&S 5) io) o) SS) o) o) os) o) os) ss] the SSL SSIS SL SE SS SL SL Sd] SL qS TH LT) RX Tv TT vv YT TO Tv Ty
. 149/232 Example 3: Dose-dependent antisense inhibition of human transthyretin in HepG2 cells Gapmers from Example 2 exhibiting significant in vitro inhibition of human transthyretin were tested at various doses on HepG2 cells. The cells were plated at a density of 20,000 cells per well and transfected using electroporation with concentrations of 625 nM, 1250 nM, 2500 nM, 5000 nM and 10,000 nM antisense oligonucleotide, as specified in Table 5. After a period After approximately 16 hours of treatment, RNA was isolated from the cells and transthyretin MRNA levels were measured by quantitative real-time PCR.
The human primer set RTS3029 was used to measure transthyretin MRNA levels.
Transthyretin mMRNA levels were adjusted according to the total RNA content, as measured by RIBOGREEN.
The results are presented as a percentage of transthyretin inhibition, in. 15 compared to untreated control cells. : Half of the maximum inhibitory concentration (ICso) of each of the o- "ligonucleotides is also shown in Table 5 and was calculated by plotting the concentrations of oligonucleotides used versus the percentage of inhibition of transthyretin mRNA expression achieved for each con- concentration, and observing the oligonucleotide concentration at which 50% inhibition of transthyretin mRNA expression was achieved in relation to the control.
As shown in Table 5, transthyretin MRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotide.
Table5 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using faulty electroporation lar ma e lt ee inses | aos26s makes 176 read them - Jos Toe | [azoota Tso xs oo jar log Í-062s | [ezoois leo ss for dos Too 00 |
- 150/232
Iso (uM ms ro ro ee | 425053 | 7th les des 425055 las les les os ——l <o62s | 425606 70 lee Jon 425659 las 166 68 82 o3 log 425679 12 24 97 [asso Tea and lee das lee doa | mo 74 st le ds TE io ao ss o 425719 84 92 98 75 le os oe for lazszas [6a 7 ss TE> & es ler des: [425738 ao | joe ss 71 e so sa joe and 62 are only 2 to 425765 SS 83 [azszes jos = 8o 8 7 ss le Tec de eae | Gapmers of Example 2 were also tested in various doses on HepG2 cells using the lipofectin transfection reagent.
The cells were plated at a density of 10,000 cells per well and transfected using electroporation with concentrations of the antisense 6.25nM, 12.5 nM, 25 nM, 50 nM and 100 nM antisense oligonucleotide, as specified in Table 6. treatment period of about 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR.
The human primer set RTS3029 was used to measure transthyretin mMRNA levels.
. 151/232 The transthyretin MRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 6, transthyretin MRNA levels were significantly reduced dose-dependent in cells treated with antisense oligonucleotide. Table 6 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using 6.25 nM 25nM lipofectin reagent [5onv J1o0onm º [and SN ANN ANN ae and ee if DT SS Ee
E [until and a e e e Es se eme FE EE Ss mr mer ses os e pes erre e
EXCM EN COR CRR CRSLEENE
. 152/232 Example 4: Dose-dependent antisense inhibition of human transthyretin in HepG2 cells Gapmers selected from Example 3 were tested in various doses on HepG2 cells. The cells were plated at a density of 20,000 cells per well and transfected using electroporation with concentrations of antisense oligonucleotide 0.0617 µM, 0.1852 µM, 0.5556 UM, 1.6667 µM and 5 µM of the antisense oligonucleotide, as specified in Table 7. After a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human starter set RTS3029 was used to measure transthyretin MRNA levels. The transthyretin MRNA levels were adjusted according to the total RNA content, measured by RIBOGREENQ. The results are presented as a percentage of transthyretin inhibition, in relation to - 15 untreated control cells. As shown in Table 7, transthyretin S MRNA levels were reduced in a dose-dependent manner in cells treated with antisense oligonucleotide. Table 7 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using electroporation [e fo e Te e de Loo as do os seas
P fe a a e e es see RA eder EM a Ca Cn a CO
- 153/2032
AE A a 2 Lars a Ta ae Te os ss es e Le E ne fm le aeea Example 5: Confirmation of the dose response of antisense oligonucleotides directed to human transthyretin in Hep3B BR Gapmers cells from Example 4 showing inhibition in vitro significant amount of 'human transthyretin were tested at various doses on Hep3B cells. The cells were plated at a density of 20,000 cells per well and transfected using electroporation with concentrations of antisense oligonucleotide 0.0206 M, 0.062 M, 0.185 M, 0.556 M, 1.6667 M and 5 M antisense oligonucleotide, as specified in Table 8. After a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer set RTS1396 was used to measure transthyretin MRNA levels. The transthyretin MRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 8, transthyretin mMRNA levels were reduced in a dose-dependent manner in cells treated with antisense oligonucleotide. The ICs9 of each oligonucleotide is also shown in Table 8. Table 8 Dose-dependent antisense inhibition of human transthyretin
- 154/232 in Hep3B cells using uM uM EM uM uM (uM) electroporation [mis | o [| 1 [2 | a [6 and os) the EA
Z ESA SS DS DA DE> 7 In aa pe and Example 6: Dose response confirmation of antisense oligonucleotides targeting human transthyretin in primary mouse hepatocytes transgenic with human transthyretin Example 5 were also tested in various doses O in primary hepatocytes of transgenic mice with human transthyretin ISIS 304309, ISIS 304311, ISIS 304312 and ISIS 420951 (see example 2) were also re-examined together with these gapmers under the same culture conditions. The cells were plated at a density of 10,000 cells per well and transfected using Cytofectin with concentrations of the antisense oligonucleotide of 18.75 nM, 37.5 nM, 75 nM, 150 nM and 300 nM, as specified in Table 9. a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer set RTS1396 was used to measure transthyretin MRNA levels. The transthyretin MRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 9, transthyretin MRNA levels were reduced in a dose-dependent manner in cells treated with antisense oligonucleotide.
. 155/232 Table 9 Dose-dependent inhibition of human transthyretin antisense in primary mouse hepatocytes using cytofectin [ess a as [er [30600 | 8 om ds 8 | | ss] [am as | 7 [if | ss | if [5]
E AEE IIS SE 2 [am a e e minutes) & 1 | s 3) mm Ds eea eos: [Bs DO Dm Ds Os [ss Tais]: Example 7: Confirmation of the dose response of human oligonucileotide directed to transthyretin in HepG2 Gapmers cells selected from Example 6 were tested in various doses in HepG2 cells. The cells were plated at a density of 10,000 cells per well and transfected using electroporation with concentrations of antisense oligonucleotide 0.062 µM, 0.185 UM, 0.556 UM, 1.66 UM and 5,000 UM of the antisense oligonucleotide, as specified in Table 10. After a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer set RTS1396 was used to measure transthyretin MRNA levels. Transthyretin mMRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 10, MRNA levels
- 156/232 of transthyretin were reduced in a dose-dependent manner in cells treated with antisense oligonucleotide. Table 10 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using electroporation NO um AM AM um um (UM) 304299 66 96 5-10-5
And the knife is only 420951 | 45 93 5-10-5 28 70 ja the om 3143
EMPIRE 49 67 90 96 so ss and ds and am jels 425757 | 21 ez [6 SS jos “joe j4115 Example 8: Confirmation of dose response of antisense oligonucleotides targeting human transthyretin in primary transgenic mouse hepatocytes with human transthyretin Example 6 Gapmers were also tested at various doses in hepatocytes primary transgenic mice with human transthyretin The cells were plated at a density of 10,000 cells per well and transfected using Cytofectin with concentrations of the 10 nM antisense oligonucleotide, 20 nM, 40 nM, and 80 nM, as specified in Table 11. After a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin MRNA levels were measured by quantitative real-time PCR. The human starter set RTS3029 was used to measure transthyretin MRNA levels. Transthyretin mMRNA levels were adjusted according to the
- 157/232 total RNA content, measured by RIBOGREENO. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 11, transthyretin mMRNA levels were reduced in a dose-dependent manner in cells treated with antisense oligonucleotide. Table 11 Dose-dependent inhibition of human transthyretin antisense in primary mouse hepatocytes using cytofectin. ISIS NO | 5nM 20 nM Reason 43 7o 81 5-10-5: SE RSS E o - EEE e e o o se a meo [226670 fo fis e e and ACE ANOTa Gapmers were also tested using electroporation as the transfection agent. The cells were plated at a density of
35,000 cells per well and transfected using electroporation with 148.148 nM, 444.444 nM antisense oligonucleotide concentrations,
1,333,333 nM, 4,000 nM and 12,000 nM, as specified in Table 12. After a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin MRNA levels were measured by real-time PCR quantitative. The human primer set RTS3029 was used to measure transthyretin MRNA levels. The levels
- 158/232 levels of transthyretin mRNA were adjusted according to the total RNA content, measured by RIBOGREEN.
The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells.
Table12 Dose-dependent inhibition of human transthyretin antisense in primary mouse hematocytes using electroporation nM nM nM nM sosass 175 = jos dos los oo —Is1os | ss jo or ox —lstos | e es e le 420015 RE E Ro ms 6s se le [5105 | 6 F: ss lee des las da caes | 6th Ee e e es | [azsere dos or do o and [26605 jon fer os 96 os - [2135 | [26756 1755 oa dos los lares | leszar ro lee os los os os Less dor or dos Jos es Example 9: Confirmation of dose response of antisense oligonucleotides targeting human transthyretin in primary hepatocytes cynomolgus Gapmers of Example 6 were also tested at various doses in primary hepatocytes of cynomolgus monkeys.
The cells were plated at a density of 35,000 cells per well and transfected using electroporation with antisense oligonucleotide concentrations of 1,250
. 159/2392 nM, 2,500 nM, 5,000 nM, 10,000 nM, and 20,000 nM, as specified in Table 13. After a treatment period of about 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer set RTS1396 was used to measure transthyretin MRNA levels. Transthyretin mRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 13, transthyretin MRNA levels were reduced in a dose-dependent manner in hepatocytes treated with ISIS oligonucleotides.
In the absence of a complete genetic sequence of cynomolgus monkeys in the NCBI database, oligonucleotides were tested for cross-reactivity against the genetic sequence of rhesus monkeys,. 15 because the two species are of the same genus, 'Macaca'. Human oligonu- 'cleotides cross-react with the rhesus monkey's transthyr- and retina gene, designated here as SEQ ID NO: 4 (exons 1-4 taken from GENBANK Accession No. 001105671.1). The "mismatches" indicate the number of mismatches between the human oligonucleotide and the rhesus monkey transthyretin gene. "n / a" indicates that the human oligonucleotide has more than 3 mismatches with the rhesus monkey transthyretin gene and consequently does not cross-react with it.
= ls 8 É FE õ o É ã x S 8 | Ss a & o É
S S 3 E o o O o angel angel o ke! o 8 = 2 E E go = ES o and 2 E S at 2 o & | SS 2 ERSIAFIRIRIRIDIDIICIDIDNrIrIDr = Ojo ricsiajol = / o / o / o / o / o / o angel o E o Yo To Tv already o / o / o / o o o. Ss ss o Ss | 82 z SE - - * - - e 8 = o 8 E 8 ç = 2 E «/ w /« lo 2 / waooooo = eo 2 = o 3 FS SR SR RR RIRI5 / 2/8 Ss ON TV | O o 6/8 O io [1 |) Y | Y jo | Y | v / 9/19) O = 2el lelelo o e e Es ss ao also In NINO Sse e ele he and als seo a e | E 2 E | Vivi vV | V VR o vVIN | o | VIVv | V e o - 2 oz = o SS store o = of S E o / 8 | 8 ST SS Ts 83 o o es - o - o O mo Oi = jo o To E Po BR 8 8 RBS SSB S / S
E s S&S ç = ala n = lx o o = e | o 8 6 E 8 R S / S RS 3 o | 8 STS [8/88 to o 8 o R = hoocehbtkkkaL eerbein o ek 8 8 si E S 8 RISIBER SD RS RSRS) s 2 pio E Bis E Fiis cl alo rn aro! alleles link LI AND NIB RS BBB o FT BF 8 / RIR with o Ds | es angels Ml oi o / O / 0/0 rj oiN | the DJ oO = = | = / oló / 50 / o0 / r / O / O / mjójlio CS Ss, IS ssa to 8 8 S / 8 Ss SS SSS 2 o SS RR SSSSSS SS SSS 8 E RO SSSSISSSSSS | SR 8 SS = ge eaea Ns NA aNRO c 161/232 Example 10: In vivo inhibition of human transthyretin in transgenic mice with human transthyretin Example 6, demonstrating significant inhibition of transthyretin MRNA, were tested in transgenic mice having human transthyretin homogeneity and the effectiveness of gapmers was evaluated.
Treatment Fifteen groups of four transgenic female mice with hTTR each were administered subcutaneously twice a week for four weeks with 25 mg / kg of ISIS 304299, ISIS 304309, ISIS 304311, ISIS 304312, ISIS 420915, ISIS 420951, ISIS 425653, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, ISIS 425755, or ISIS 425757.
Another group of four hTTR transgenic female mice was injected with 25 mg / kg of the ISIS 141923 control oligonucleotide (CCTTCCCTGAAGGTTCCTCC, designated here as SEQ ID NO: 165) twice a week for four weeks. : Another group of four female transgenic mice with hTTR were injected subcutaneously with PBS twice a week for four weeks.
The mice injected with PBS served as a control group.
Blood samples were collected from all groups at weeks 0,1,2,3e4 for analysis of the plasma transthyretin level.
The rats were sacrificed two days after the last dose and the livers were collected for analysis of the target MRNA.
RNA analysis RNA was extracted from liver tissue for analysis of transthyretin by real-time PCR using the RTS3029 primer set. The results are presented as a percentage of inhibition of human transthyretin, in relation to the PBS control.
As shown in Table 14, treatment with ISIS antisense oligonucleotides resulted in significant reduction of human transthyretin MRNA compared to the PBS control. Treatment with the control oligonucleotide, ISIS 141923 did not result in significant reduction of transthyretin, as expected.
> 162/232 Table 14 Inhibition of human transthyretin mRNA in the liver of transgenic mice with hTTR compared to the PBS control 204200 304309 83 304311 63 304312 64 420915 82 PE EE - 425653 66 425655 76 Healthy: 425679 93 425695 82 = : - 425737 '76: 425755 In Bro im - 141923 - 28 - Protein analysis Levels of transthyretin protein were measured in the plasma of transgenic mice by ELISA using a polyclonal anti-transthyretin antibody (Apcam Ab37774) and a detection antibody of sheep anti-TTR with horseradish peroxidase (Abcam no. cat. 35217). The color reaction was developed by the TMB ImmunoPureO substrate kit and measured at 450 nm using a microplate spectrophotometer.
Plasma samples were taken pre-dose and on days 7, 14 and 28. The results are shown in Table 15 expressed as a percentage of inhibition compared to the pre-dose levels and demonstrate a time-dependent reduction in the levels of protein with ISIS oligonucleotide treatment.
Tablei5 Inhibition of human transthyretin protein in the plasma of mice
.- 163/232 transgenic dongs with hTTR in relation to the pre-dose levels. of peace lo fo le a de - | Day 14 xm Day 21 81 95 100 Daze 13 ls = es ss Table 15-continuation when exisiting ISIS 425755 so 66 de os bia21 | so 88 Day 28 100 91 8 Body weight and organ weight 'The body weights of the mice pre-dose º 5 and the end of the treatment period were measured.
Body weights are shown - in Table 16 and expressed as a percentage of increase over the PBS control weight done before the start of treatment.
The weights of the liver, spleen and kidney were measured at the end of the study, and are also shown in Table 16 as a percentage change over the respective weight of the PBS control organs.
As shown in Table 16, there was no significant change in body or organ weights as a result of treatment with antisense oligonucleotide.
Table 16 Percentage change in the body and organ weights of transgenic mice after treatment with oligonucleotide.
PBs go 1st ISIS 304300 1.0 12 Isis sea As and ls a Body weight to mn Kidney ISIS 420915 nm 11 11 issa ae to AS ISIS 425653 E 0.9 1.0 ISIS 425655 13 1.0 = go to ISIS 425679 1.0 16 ISIS 425 695 1.8 10 ISIS 425 736 12 1.0 1.0 ISIS 425 737 12 11 2: 1 13 1st
1.0 os Liver function - To assess the effect of ISIS oligonucleotides on liver function, plasma transaminase concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus —AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 17, expressed in IU / L. Plasma bilirubin levels were also measured using the same clinical chemistry analyzer; results are also shown in Table 17 and expressed in mg / dL. Table 17 Effect of treatment with antisense oligonucleotide on metabolic markers in the liver of transgenic mice ee | ALTOMO - [ncia
0.23 lisisso200 - ao = 1a 019
0.20 lsissossir aa leo Jor
ISIS 304312 0.17 s 0.26 o17 - 35 0.20 - KNOWING Io 0.16 follow Jeso ga nn MA qã skirt ms mo 0.20 4s
0.16 these girls have you
0.24 o o19 and Kidney function To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are shown in Table 18, expressed in mg / dL. The data indicate that antisense inhibition of transthyretin has no effect on BUN levels in these transgenic mice. Table 18 Effect of treatment with antisense oligonucleotide on BUN (mg / dL) in the kidney of transgenic mice E iBuNmeD 29 28 26
ISIS 425679 26 ISIS 425736 25: ISIS 425757 ISIS 141923 Example 11: Tolerability of antisense or labeled oligonucleotides to human transthyretin in CD1 mice CD1Q mice (Charles River, MA) are a multi-use model of mice, often used for safety and testing efficiency.
The rats were treated with the ISIS antisense oligonucleotides selected from the studies described in Example 10 and evaluated for changes in the levels of various metabolic markers.
Treatment Groups of eight CD1 mice were injected subcutaneously twice a week with 50 mg / kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, and ISIS 425755. Four mice from each group were evaluated at week 2 and week 6 of the treatment period.
Three days after the last dose at each time point, body weights were taken, the mice were sacrificed and the organs and plasma were collected for further analysis.
Body and organ weights The body weights of the mice were measured pre-dose and at the end of each treatment period (two and six weeks). Body weights are shown in Tables 19 and 20, and expressed as a percentage of increase over the PBS control weight done before the start of treatment. The weights of the liver, spleen and kidney were measured at the end of the study, and are also shown in Tables 19 and 20 as a percentage change over the respective weights of the PBS control organs. Table 19 Change in body and organ weights of ICD mice after treatment with antisense oligonucleotide (%) at week 2 | Comoral weight [Fig - ÍBaço - [Rm | o 11 x ht 11 11 10
1. mM 13 17 and 12! 11 1.0 14 the ISIS 425736 10 Table20 Change in body and organ weights of the ICD mice after treatment with antisense oligonucleotide (%) in week 6 lago mea mente me RO 12 Ra de ae | 13 Lisisa20ois 130 to 15 jog = |
[| Jresocomora [Figado —Jeaço - Rm 13 11 db 14 12 13 2 and he ISIS 425736 St 12 jog | * lisisaestss 13 18 give no Liver function To assess the effect of ISIS oligonucleotides on liver function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus —AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results. are shown in Tables 21 and 22, expressed in UI / L. Plasma levels | bilirubin and albumin matics were also measured using the same clinical chemistry analyzer and the results are also shown in Tables21 and 22. Table 21 Effect of treatment with antisense oligonucleotide on metabolic markers in the liver of CD1 mice at week 2 ALT (IUL) | AST (IU / L) Fes las a - Tom Je |
CA EEE 1818 425658 023
[Jaraum Jasraum | eitmueina mara) | expensive atpumina) | 1818 425755 8s Table 22 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of CD1 mice at week 6 ALT (IU / L) AST (IU / L) Bilirubin Albumin - | (mgrdl g / dL) PBS 31. 67 0.20 5.6 sa mn 5.2 [wing azastsllie o Jar Tear sa - EEE: ISIS 425656 261 0.17! ISIS 425736 | 41 47 41 Kidney function 5 To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) and creatinine concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY ). The results are shown in Tables 23 and 24, expressed in mg / dL.
Table 23 Effect of antisense oligonucleotide treatment on metabolic markers in the kidney of CD1 mice at week 2 LL 1 BUN Creatinine ISIS 304299 26 - [ssa [ss to ISIS 425655 29 and [022 Isis425656 - - | 25 0.19 ISIS 425679 28 0.19 ISIS 425695 29 o 'Table 24 to 5 Effect of antisense oligonucleotide treatment on metabolic markers in the kidney of CD1 mice at week 6. BUN - - Jcreatinina FE a º or Issa a 1º [sta zo [096 Issa a Hematology assays The blood obtained from all groups of mice was sent
Antech Diagnostics for measurements and analysis of hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC), as well as measurements of differential blood cell counts, such as those of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content.
The results are shown in Tables 25-28. The percentages given in the tables indicate the percentage change in the total blood cell count compared to the PBS control.
Those antisense oligonucleotides that did not affect a decrease in platelet count of less than 70% of the PBS control or an increase in monocyte count of more than two times were selected for further studies.
Table 25 Effect of the treatment of the antisense oligonucleotide on the account. 15 complete blood cell gem (%), compared to PBS control f in CD1 mice at week 2 globin [eniss Tas de Te le he | 14 GRE AR ER EA to: [420051 rim 5 5 lu da lo Lies ee a e TR O es te Je Te Je Te o RC [this is le lg ds a o [azseos are da 1a o lo | | Less Jem le de e fa IN ROS [ie from the ISO Table 26 Effect of antisense oligonucleotide treatment on complete blood cell count (%), compared to PBS control in CD1 mice at week 6 E rFEr EEE NO. globin een iz a ie 1 s 2 1 S is ao + e 12 ste sn a 1a IT A 425655 a 2 7 7 2 lo e | » se e lo & es 7 donate Jo | PSSSFPEN PERNITENIP Emo de das de o
”Table 27
- Effect of antisense oligonucleotide treatment on differential blood cell count (%), compared to control
—OfPBSin CD1 mice at week 2
Platelets n se peopl e O SO Devel in a e E 7 E e
Table 28 Effect of antisense oligonucleotide treatment on the differential blood cell count (%), compared to the PBS control in CD1 mice at week 6 Eme and is monocytes 2 420051 6 so 22 25 6 20 125736: +23 - 5 Example 12: Measurement of the antisense oligonucleotide half-life in the CD1 mouse liver The CD1 mice were treated with the ISIS antisense oligonucleotides from the studies described in Example 11 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide - being degraded and eliminated from the liver was evaluated.
Treatment Groups of twelve CD1 mice were injected subcutaneously twice a week for 2 weeks with 50 mg / kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, 1SIS425679, ISIS 425695, ISIS 425736, ISIS 425737, and ISIS 425755. Four mice from each group were sacrificed 3 days, 28 days and 56 days followed by the final dose.
Livers were harvested for analysis.
Measurement of oligonucleotide concentration The concentration of the complete oligonucleotide, as well as the total concentration of the oligonucleotide (including the degraded form) was measured
gives. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consists of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a modified 27-mer2'-O-methoxyethyl phosphorotic oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTITITIT, designated here as SEQ ID NO: 166) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantification (LLOQ) of approximately 1.14 UV9 / 9. Half-lives were calculated using the WinNonlin (PHARSIGHT) software.
The results are shown in Tables 29 and 30, expressed pg / g of liver tissue. The half-life of each of the oligonucleotides is shown in Table 31. Antisense oligonucleotides with half-lives within 11-34 days were chosen for further studies.
. 15 Table29 "Concentration of the full length oligonucleotide (pg / g) in the liver of CD1 mice 28 days 56 days 304299 E an 254 phases 173 109 33 425656 180 o | a Table 30 Total concentration of the oligonucleotide (p9g / 9g) in the liver of the CD1-mice
EO 26 of s5 152 425655 298 87
E [125,570 Tom 107 425695 263 143 425736 Mm. 140 425737 - 266 31 4257155 - 1337 140 Table 31 Oligonucleotide half-life (days) in the liver of CD1 mice [ss Tvesvaa (ay - 304299 12 o. 304309 ss. 420915 E - 420057 1a 425655 21 425656 - 17 425678 18 425695 23 425755 24 Example 13: Tolerability of antisense oligonucleotides labeled for human transthyretin in Sprague-Dawley rats; Sprague-Dawley rats were treated with ISIS antisense oligonucleotides selected from the studies described in Examples 11 and 12 and evaluated for changes in the levels of various markers Treatment Body weights, complete blood counts and counters
Differential blood count, as well as the urinary protein / creatinine ratio of the rats were assessed pre-dose. Groups of four Sprague-Dawley rats were injected subcutaneously twice weekly with 50 mg / kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737 and ISIS
425755. Three days after the last dose at each time point, body weights were taken, mice were sacrificed and organs and plasma were collected for further analysis. Body and organ weights The body weights of the rats were measured pre-dose and at the end of the treatment period. Body weights are shown in Table 32 and expressed as a percentage of increase over the PBS control weight done before the start of treatment. The weights of the liver, spleen and kidney were measured at the end of the study, and are also shown in the Table. 15 32 as a percentage change over the respective organ weights: PBS controls. 1 »Table 32 Change in body and organ weights of Sprague-Dawley rats after treatment with antisense oligonucleotide (%) Body weight Liver liver rudder 18 to 12 v7 16 las 14 1818 425655 | 12 [wings 19 - 1st home 17 12 186 ISIS 425 736
15. sa
As shown in Tables 32, certain compounds showed a less than 4-fold increase in the weight of the Spleen.
Liver function To assess the effect of ISIS oligonucleotides on liver function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 33, expressed in IU / L.
Plasma levels of —bilirubin and albumin were also measured using the same clinical chemistry analyzer and the results are also shown in Table 33. Table 33 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of Sprague-Dawley rats | mg / dL) (9 / dL) = 55 015 69 154 0.15 so or 28 "353 ISIS 425655 | 312 weights and loss of function Function To assess the effect of ISIS oligonucleotides on kidney function, plasma nitrogen concentrations blood urea (BUN) and creatinine were measured using a self-reported clinical chemistry analyzer
tinted (Hitachi Olympus AU400e, Melville, NY). The results are shown in Table 34, expressed in mg / dL. The ratio of total urinary protein and creatinine was also assessed and shown in table 35. Table 34 Effect of antisense oligonucleotide treatment on metabolic markers (mg / dL) in the kidney of Sprague-Dawley rats
0.26 to 040 0.33
0.26 ISIS 420951 0.47 ISIS 425655 0.40 ISIS 425656 0.34 ——. 042: 29 - lose Table 35 Effect of antisense oligonucleotide treatment on total urinary protein / creatinine in the kidney of Sprague Dawley E rats at 0.82 0.95 5.30 Lisisazest Fogo Ugo
LL lPredose ISIS 425736 5.85 3.70 As shown in Tables 34 and 35, certain compounds have shown a minor 7-fold increase in total urinary protein / creatinine in the kidney of these rats.
In addition, certain compounds have shown a less than 6-fold increase in total urinary protein / creatinine - the norm of these rats.
Hematology assays The blood obtained from all groups of rats was sent to Antech Diagnostics for measurements and analyzes of hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and - mean corpuscular hemoglobin concentration (MCHC), as well as i measurements of differential blood cell counts, such as those of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content.
The results are shown in Tables 36 and 37. The percentages indicated in the tables indicate the percentage variation in the total blood cell count compared to the PBS control.
Table 36 Effect of the treatment of antisense oligonucleotide on the complete blood cell count (%), in comparison with the PBS control Sprague-Dawley ErrEF FERE) NO. globina person os e IS IS Eeoeeea Jan a ue Ta eg TOO [20015 o 16 when giving 4 to Ts Lezoost 5 to ds q 1a 1a almost deco ar las 12 o W
EFFEFFEEF NO. globin 3 49 st 1st and n e e la 2 2 "” 4 Table 37 Effect of antisense oligonucleotide treatment on complete blood cell count (%), compared to PBS control in Sprague-Dawley rats Lymphocytes 304209: 304309 +10: 420915 “6 E: + s 7 + o 170 [er - Ja o 4 am e s e se se Example 14: Pharmacokinetic studies of the concentration of antisense oligonucleotide in the liver and kidneys of Sprague rats -Dawley The Sprague-Dawley rats were treated with the ISIS antisense oligonucleotides from the studies described in Example 13 and the oligonucleotide half-life as well as the time taken for the oligonucleotide to be degraded and eliminated from the liver and kidney.
Treatment Groups of four Sprague-Dawley rats were injected subcutaneously twice for 2 weeks with 20 mg / kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425736, ISIS 425736 , ISIS 425737 and ISIS 425755. Three days after the last dose, the rats were sacrificed and the livers and kidneys were collected for analysis.
Measurement of oligonucleotide concentration The concentration of the complete oligonucleotide, as well as the total concentration of the oligonucleotide (including the degraded form) was measured.
The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consists of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction.
An internal standard (ISIS 355868, a modified phosphorothioate oligonucleotide. 15 27-mer 2'-O-methoxyethyl, GCEGTTTGCTCTTCTTCTTGCGTTTTIT, designated 'here as SEQ ID NO: 166) was added prior to extraction.
Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantification (LLOQ) of approximately 1.14 V9 / 9. The results are shown in Tables 38 and 39, expressed as g / gde liver or kidney tissue.
The kidney / liver ratio of the full-length oligonucileotide was also calculated and shown in Table 38. Table 38 Concentration of the full-length oligonucleotide (nug / g) and ratio in the liver and kidney of Sprague-Dawley SENo Rm 68 25670 rats ISIS NO.
Kidney Kidney / Liver Ratio Table 39 Total concentration of oligonucleotide (nug / g) in the liver and kidney of Sprague-Dawley rats ISIS NO.
Liver Kidney 304299 208 653 304309 409 803: 425655 340 764 425656 329 B 425679 710: 425737 “186 Example 15: In vivo dose-dependent inhibition of transthyretin — human in transgenic mice Transgenic mice containing the human trans-retretin gene were dosed in doses crescents of ISIS oligonucleotides selected from studies described in Example 14 to assess the effect of dose-dependent inhibition of human transthyretin in these mice.
Treatment Groups of four mice, two males and two females, were injected subcutaneously twice a week for 4 weeks with 4 mg / kg, 10 mg / kg or 25 mg / kg of ISIS 304299, ISIS 420915, ISIS 420951 , ISIS 425679, ISIS 425736, ISIS 425737, or ISIS 425755. A group of four mice, two males and two females, was injected subcutaneously twice a week for 4 weeks with 25 mg / kg of the control oligonucleotide, ISIS 141923. A control group of four
dongs, two males and two females, were injected subcutaneously twice a week for 4 weeks with PBS.
Plasma samples from each group were taken on days 0, 7, 14, 21 and 28. Two days after the last dose, the mice were sacrificed and the organs were collected for further analysis.
RNA analysis RNA was extracted from liver tissue for analysis of transthyretin by real-time PCR using the RTS3029 primer set. The results are presented as a percentage of inhibition of human transthyretin, in relation to the PBS control.
As shown in Table 40, treatment with ISIS antisense oligonucleotides resulted in a significant dose-dependent reduction in human transthyretin mRNA compared to the PBS control.
Treatment with the control oligonucleotide, ISIS 141923 did not result in a significant reduction in transthyretin, as expected. . 15 Table40 To Inhibition of human transthyretin MRNA in the liver of mouse transgenic dongs with hTTR in relation to PBS control Dose (spring) Ml E to Ml
Dose (Mold) "10 79 Protein analysis Transthyretin protein levels were measured in the plasma of transgenic mice by ELISA using a polyclonal anti-transthyretin antibody (Abcam Ab37774) and an anti-TTR sheep detection antibody with horseradish peroxidase (Abpcam cat. No. 35217) The color reaction was developed by the TMB ImmunoPure & substrate kit and measured at 450 nm using a microplate spectrophotometer. Plasma samples were extracted pre-dose and on days 7, 14, 21 and 28. The results are shown in Table 41 expressed as a percentage of inhibition compared to the 10 levels of pre-dose and demonstrate a time-dependent and dose-dependent reduction in protein levels with treatment with ISIS oligonucleotides Table 41 Inhibition of the human transthyretin protein in the plasma of transgenic mice in relation to the pre-dose levels chosen by Pi EA Ee je ee | ope ice
FE ES Rob E Rh 4 do as jo o 420051 25 - o les oe (100 dio | LH le - ae wool le das la ae Tx e e
[Dao Diaz Data | Dia21 | Dia2s | of this launch of the des er lee las de lee an e 1a: | E e e te e ar | 223755 oo - Ja dee o e lat o an la Tese es o lo fo lo lo jo | desrsz Jem de Tay fans Jess lee | e lo lar Te des d & s | eb are reading wool | 45795 as - | fes los fox too | o e ls nm le de 4 lo ja 2 18 los | Body weight and organ weight - The body weights of the mice were measured pre-dose] and at the end of the treatment period.
Body weights are shown. in Table 42 and expressed as a percentage of increase over the weight control of PBS done before the beginning of treatment.
The weights of the liver, spleen and kidney were measured at the end of the study, and are also shown in Table 42 as a percentage change over the respective weights of the PBS control organs.
Table 42 Change in body and organ weights of transgenic mice after treatment with antisense oligonucleotide (%) Ps ds o o o | 1818 504260 [1 ft to Er and Er and FP Ee Eta ão
It's body weight | Liver
AEE peer ERES SE SIN CORE ISIS425755 - | 25 +21 AND
SO 'Liver function. To assess the effect of ISIS oligonucleotides on liver function, plasma transaminase concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 43, expressed in IU / L. Plasma bilirubin levels were also measured using the same clinical chemistry analyzer; results are also shown in Table 43 and expressed in mg / dL. Table 43 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of transgenic mice [ess ímata [ATT [ASTOUD. - [TT MAÃO | And what are O 5
[The E EE EE as Ro ee is EA Ca E o: o ESTAS Es EC Ec Rir Kidney function To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are shown in Table 44, expressed in mg / dL.
Table 44 Effect of treatment with antisense oligonucleotide on BUN (mg / dL) norim of transgenic mice [the lmesemaro - lean ELI to OO ISIS 304209 4
[Joocsecnata
ISIS 420 915 25 24
10 25
- 20
ISIS 420 951 25 24
10 - 25 - d ISIS 425 679 25 10 n and A 22
ISIS 425 736 22 -
22 to 1818 425737 126; 10
- ISIS 425755 25 23 10 - 4 ISIS 141923 Example 16: In vivo inhibition of human transthyretin in cells
transgenic mice with human transthyretin
Antisense oligonucleotides with motifs MOE 5-10-5, ISIS 304313, ISIS 420913, ISIS 420919, ISIS 420921, ISIS 420922, ISIS 420937, ISIS 420944, ISIS 420947, ISIS 420949, ISIS 420950, ISIS 420952, ISIS 420953, ISIS 420953, ISIS 420955, ISIS 420957, and ISIS 420959 from Table 4. These antisense oligonucleotides that showed 65% inhibition or more of transthyretin mRNA were selected and tested in transgenic mice containing the human transthyretin gene.
Additional oligonucleotides with sequences undermining ISIS 420951 (GTTT-TATTGTCTCTGCCTGG (SEQ ID NO: 116)) and for a variety of reasons have also been designed for testing in transgenic mice.
These oligonu-
Additional cleotides were ISIS 450518 (TITTATTGTCTCTGCCTG (SEQ ID NO: 5-8-5 MOE (SEQ ID NO: 167)), ISIS 450519 (GTTT- TATTGTCTCTGCCTGG, MOE 6-8-6 (SEQ ID NO: 116)), ISIS 450520 (GTTTTATTGTCTCTGCCTGG, MOE 3-10-7 (SEQ ID NO: 116)), IS-IS 450521 (GITITATIGTCTCTGCCTGG, MOE 7-10-3 (SEQ ID NO: 116)), ISIS 450522 (GTTITATTGICTCTGCCTGG, MOE 2-10 -8 (SEQ ID NO: 116)), and ISIS 450523 (GTTITATTGTCTCTGCCTGG, MOE 8-10-2 (SEQ ID NO: 116)). Treatment Groups of four transgenic mice with hTTR, two males and two females, were administered by subcutaneous twice a week for four weeks with 25 mg / kg of ISIS 304313, ISIS 420913, ISIS 420919, ISIS 420921, ISIS 420922, ISIS 420937, ISIS 420944, ISIS 420947, ISIS 420949, ISIS 420950, ISIS 420952, ISIS 420952 , ISIS. 15 420953, ISIS 420955, ISIS 420957, ISIS 420959, ISIS 425518, ISIS 425519,: ISIS 425520, ISIS 425521, ISIS 425522, or ISIS 425523. A control group of four mice, two males and two females, was injected subcutaneously with PBS twice a week for 4 weeks.
Blood samples were collected from all groups on days 0, 14, and 28 for analysis of the plasma transthyretin level.
The rats were sacrificed two days after the last dose and the livers were harvested for analysis of the target MRNA.
RNA analysis RNA was extracted from liver tissue for analysis of transthyretin by real-time PCR using the RTS3029 primer set. The results are presented as a percentage of inhibition of human transthyretin, in relation to PBS control.
As shown in Table 45, treatment with ISIS antisense oligonucleotides resulted in a significant reduction in human transthyretin MRNA compared to the PBS control.
Table45 Inhibition of human transthyretin MRNA in the liver of transgenic mice with hTTR in relation to PBS ss control 73 450519 sr 85 450522 450523 420951 94 Protein analysis Transthyretin protein levels were measured in plasma in transgenic mice by ELISA using a polyclonal anti-transthyretin antibody (Abcam Ab37774) and a sheep detection antibody - antiTTR with horseradish peroxidase (Abcam no. cat. 35217). The color reaction was developed by the TMB ImmunoPure & substrate kit and measured at 450 nm using a microplate spectrophotometer.
Plasma samples were taken pre-dose and on days 7, 14 and 28. The results are shown in Table 46 expressed as a percentage of complete inhibition.
compared to pre-dose levels and demonstrate a time-dependent and dose-dependent reduction in protein levels with treatment with ISIS oligonucleotides. Table 46 Inhibition of the human transthyretin protein in the plasma of transgenic mice with hTTR in relation to the pre-dose levels [Joao Emo [school and 7 sisis lo la Lisisazoets lo lr 82 E 83 sam oo é yen lo le: same o 1 65: ISIS 420949 EB —— 7 to Lisisazossa fo sisa20063 lo ————> -> et eteseosss - lo fan iam [IF the [1s1s420069 fo ————> -> Jes EXIT AND
REACTOR E fassa - Jum am fis asonae Jo o an lar fissasanes Ta o mm ese lo es damage
Liver function To assess the effect of ISIS oligonucleotides on liver function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus — AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 47, expressed in IU / L.
Plasma bilirubin levels were also measured using the same clinical chemistry analyzer; results are also shown in Table 47 and expressed in mg / dl.
Table 47 Effect of treatment with antisense oligonucleotide on metabolic markers in the liver of transgenic mice | - Tataum Tasraur 'ISIS 304313 42 79 0.16: o17, ISIS 420937 33 E isisa20044 38 a Jow Hesse - er e nO Pere sogçes are ad A phases Tr Bs 0.18 Est A ISIS 450 518 103 200 0.20
E ALTOUL 270 ISIS 450522 0.14 eg asoses - en am ow Isis420061 - 67 lim en OS Kidney function To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) concentrations were measured using an analyzer automated clinical chemistry (Hitachi Olympus AU400e, Melville, NY). The results are shown in Table 48, expressed in mg / dL. Table 48. Effect of treatment with antisense oligonucleotide on BUN É (mg / dL) in kidney of transgenic mice
E PBS ISIS 420913 30 1818 420919: ISIS 420937
ISIS 420959 29 ISIS 450518 28 ISIS 450519 25 29 24 ISIS 450522 20 ISIS 450523 21 - ISIS 420951 25 Example 17: Tolerability of antisense oligonucleotides targeting human transthyretin in CD1 mice CD1 mice were treated with the 16 antisense oligonucleotides from ISIS example 16 and assessed for changes in the levels of various metabolic markers.
Treatment: Groups of eight CD1 mice were injected subcutaneously twice a week with 50 mg / kg of ISIS 304313, ISIS o 420913, ISIS 420919, ISIS 420921, ISIS 420922, ISIS 420937, ISIS 420947, ISIS 420947, ISIS 420949, ISIS 420950, ISIS 420951, ISIS 420952, ISIS 420953, ISIS 420957, ISIS 420959, ISIS 425518, ISIS 425519, ISIS 425520, ISIS 425521, ISIS 425522, or ISIS 425523. Three days after the last dose at each time point, body weights were taken, mice were sacrificed, and organs and plasma were collected for further analysis.
Body and organ weights The body weights of the mice were measured pre-dose and at the end of each treatment period (two and six weeks). Body weights are shown in Table 49 and expressed as a percentage of increase over the PBS control weight done before the start of treatment.
The weights of the liver, spleen and kidney were measured at the end of the study, and are also shown in Table 49 as a percentage change over the respective weights of the PBS control organs.
Table 49 Change in body and organ weights of CDI mice after treatment with antisense oligonucleotide (%) at week 6 ISIS 420921 | 11 2.2. ISIS 420955 | 1,2 22 Bo Liver function To assess the effect of ISIS oligonucleotides on liver function, plasma transaminase concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 50, expressed in IU / L.
Plasma bilevel levels
rubin and albumin were also measured using the same | Clinical chemistry and results are also shown in Table 50. Table 50 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of CD1 mice [[SsS0T a sa 73 73 0.15 [ssa oa es - BE A to CNN ISIS 450519 64 0.12 ISIS 450520 350 270 beasts SS a and A [SIS 220957 67 as Kidney function To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) and creatinine concentrations were measurements using a self-tinted clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented
shown in Table 51, expressed in mg / dL. Table 51 Effect of treatment with antisense oligonucleotide on BUN (mg / dL) in the kidney of CD1 mice ISIS 304313 29 ISIS 420913 30 ISIS8420919 | 29 ISIS 420921 29 ISIS 420922 27 ISIS 420937 29 z7:. ISIS 420950 34. - ISIS 420952 23: ”ISIS 420953 34 'ISIS 420955 24 [SSB o ISIS 420959 29 ISIS 450518 28 à ISIS 450519 25 [ssasoso - o 24 ISIS 450522 29
AND —Hematology assays The blood obtained from all groups of mice was sent to Antech Diagnostics for measurements and analysis of hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC), as well as measurements of differential blood cell counts,
such as those of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content. The results are shown in Tables 52 and 53. The percentages indicated in the tables indicate the percentage change in the total blood cell count compared to the PBS control.
Table 52 Effect of antisense oligonucleotide treatment on complete blood cell count (%), compared to PBS control in mice CD1 globin a and EEE as EE xe) [1142004 T6t a Ts To 7 Ts Ts E ACER SAC AE SEA) [isisasosaa [res as ar pe pe [iss a20051 [356 Tas Ter Ta Tao Te 5 Table 53 Effect of antisense oligonucleotide treatment on differential blood cell count (%) compared to PBS control in CD1 mice [| Uintocese Tyrant ISIS 304313 +49 ISIS 420913 +39 21 1818 420919 +49 ISIS 420921 +25 ISIS 420922 | -653 +46 ISIS 420937 +57 ISIS 420944 +37 -28 +18 +49 a E ISIS 420949 +24 + ”1sis420050 | -5s0 - - j + ao o ISIS 420052 28 ISIS 420953 +35 -34 í s7 34 - ISIS 420957 | -71 +61 -28 'ISIS 420959 | -52 -24 1 ISIS 450518 -28 216 ISIS 450519 +41 +55 ISIS 450520 +34 lo +7 ISIS 450521 14 +21. ISIS 450522 +17 +58 1 1 o Example 18: Tolerability of antisense oligonucleotides targeting human transthyretin in Sprague-Dawley rats ISIS oligonucleotides selected from the studies described in Example 17 were also evaluated in Sprague-Dawles rats and evaluated for changes in the levels of various metabolic markers.
Treatment Body weights, complete blood counts and counters
Differential blood count, as well as the urinary protein / creatinine ratio of the rats were assessed pre-dose.
Groups of four Sprague-Dawley rats were injected subcutaneously twice a week with 50 mg / kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, elISIS 420959. Three days after the last dose in at each time point, body weights were taken, mice were sacrificed, and organs and plasma were collected for further analysis.
Body and organ weights The body weights of the rats were measured pre-dose and at the end of the treatment period.
Body weights are shown in Table 54 and expressed as a percentage of increase over the PBS control weight done before the start of treatment.
The weights of the liver, spleen and kidney were measured at the end of the study, and are also shown in Table 54 as a percentage change over the respective weights of the PBS control organs. = Table 54 - Change in body and organ weights of Sprague-] Dawley rats after treatment with antisense oligonucleotide (%) Body weight EEE E a As shown in table 54, the compounds demonstrated a less than 10-fold increase in body weight. organ of these rats.
In addition, certain compounds have shown a less than 7-fold increase in organ weight in these mice.
While certain compounds have shown a less than 6-fold increase in organ weight in these mice.
Certain compounds have shown a less than 5-fold increase in organ weight in these mice. Liver function To assess the effect of ISIS oligonucleotides on liver function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 55, expressed in IU / L. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and the results are also shown in Table 55. Table 55 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of Sprague-Dawley pag rats EFD TASTIDIS Trains TARA ES) PBS Ba a as ISIS 420921 151 011
E 398 327 [issa20057 f8r am ISIS 420950 48 Kidney function To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) and creatinine concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are shown in Table 56, expressed in mg / dL. The total urinary protein / creatinine ratio was also assessed and shown in table 56. Table 56 Effect of antisense oligonucleotide treatment on metabolic markers (mg / dL) in the kidney of Sprague-Dawley rats
BUN Creatinine ISIS 420913 0.09 ERA o Ne Table 57 Effect of antisense oligonucleotide treatment on total urinary protein / creatinine in Sprague Dawley Lo rat kidney ISIS protein / urine creatinine ratio 420913 19.51 o
E - ISIS 420922 4.72 - ISIS 420950 ser Hematology assays The blood obtained from all groups of rats was sent to Antech Diagnostics for measurements and analyzes of hematocrit (HCT), mean corpuscular volume (MCV), corpuscular hemoglobin mean (MCH) and mean corpuscular hemoglobin concentration (MCHC), as well as measurements of differential blood cell counts, such as those of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content. The results are shown in Tables 58 and 59. The percentages given in the tables indicate the percentage change in the total blood cell count compared to the PBS control. Table 58 Effect of antisense oligonucleotide treatment on the
complete blood cell count (%), compared to the PBS control in Sprague-Dawley globin rats
1.0 ea Toa oa ra [ss Eos os as Tia Tia [scams dis Jar as ar of ta jisisazossz | 31 jog Jos ea re Table 59 Effect of antisense oligonucleotide treatment on differential blood cell count (%), compared to control of PBS in Sprague-Dawley rats - the Neutrophils - | Lymphocytes: PBs 1.0 1.0 | o 7 1 16 8 o lisisa20050 08 ——— so same as Ne ha Example 19: Pharmacokinetic half-life studies of antisense oligonucleotide concentration in liver and kidney of Sprague-Dawley rats 10 Sprague-Dawley rats were treated with the ISIS antisense oligonucleotides from the studies described in Example 18 and the oligonucleotide half-life as well as the time taken for the oligonucleotide to be degraded and eliminated from the liver and kidney was evaluated.
Treatment Groups of four Sprague-Dawley rats were injected subcutaneously twice a week for 2 weeks with 20 mg / kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, elSIS 420959. Three days later the last dose, the rats were sacrificed and the livers and kidneys were collected for analysis.
Measurement of oligonucleotide concentration The concentration of the complete oligonucleotide, as well as the total concentration of the oligonucleotide (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consists of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction.
An internal standard (ISIS 355868, a modified 27-mer 2'-O-methoxyethyl phosphorothioate oligonucleotide, GCCGTTTGCTCTTCTTCTTGCGTTTTTT, designated —here SEQ ID NO: 166) was added prior to extraction.
Tissue sample concentrations were calculated using calibration curves, - with a lower limit of quantification (LLOQ) of approximately 1.14 'V9 / 9g.
The results are shown in Tables 60 and 61, expressed as g / g of liver or kidney tissue.
The kidney / liver ratio of oligonucleotide concentration was also calculated and shown in Tables 60 and 61. Table 60 Concentration of full length oligonucleotide (vg / g) and ratio in the liver and kidney of Sprague-Dawley Rim rats Kidney / Liver 285 1º - 293 20 22 m and 26:
25
Table 61 Total oligonucleotide concentration (ug / g) in the liver and kidney of Sprague-Dawley rats [earthquake - [Fado - [Rm [Ratio Ratio | 310 305 19 out and 486 E 156 28 202 Example 20: In vivo dose-dependent inhibition of human transthyretin in transgenic mice ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420957 and ISIS o 420959, as shown in good efficacy and tolerability, as demonstrated - shown in Examples 16-19, the dose-dependent study o was chosen. of target knockdown in transgenic mice that contain the human transthyretin gene.
ISIS 420950 and ISIS 420955, which demonstrated 90% or more of target knockdown, but which also demonstrated toxicity in CD1 mice (Examples 16-19) were also chosen for this study for comparison.
Treatment 1 Groups of four mice, two males and two females, were injected subcutaneously twice a week for 4 weeks with 4 mg / kg, 10 mg / kg or 25 mg / kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS 420959. A group of four mice, two males and two females, was injected subcutaneously twice a week for 4 weeks with 25 mg / kg of the control oligonucleotide, ISIS 141923 A control group of four mice, two males and two females, was injected subcutaneously twice a week for 4 weeks with PBS.
Plasma samples from each group were taken on days 0, 14 and 28. Two days after the last dose, the mice were sacrificed and the organs were collected for further analysis.
Analysis of RNA RNA was extracted from liver tissue for the analysis of the transthyretin by real-time PCR using the RTS3029 primer set. The results are presented as a percentage of inhibition of human transthyretin, in relation to PBS control.
As shown in Table 62, treatment with the ISIS antisense oligonucleotide resulted in a significant, dose-dependent reduction in human transthyretin mRNA compared to the PBS control. Treatment with the control oligonucleotide, ISIS 141923 did not result in significant reduction in transthyretin, as expected.
Table 62 Inhibition of human transthyretin MRNA in the liver of mice. 15 - Transgenic danoids with hTTR in relation to PBS control | Dose (M9lo): 420913 25 78 to 420921 25 76 vo 4 13 10 53: E to 1st hand A to20057 inhibition 120960 Protein analysis Levels of transthyretin protein were measured in plasma in transgenic mice by ELISA using an antibody polyclonal anti-transthyretin (Abcam Ab37774) and an anti-TTR sheep detection antibody with horseradish peroxidase (Abcam no. cat. 35217). The color reaction was developed by the TMB ImmunoPure & substrate kit and measured at 450 nm using a microplate spectrophotometer. Plasma samples were extracted pre-dose and on days 7, 14, 21 and 28. The results are shown in Table 63 expressed as a percentage of inhibition compared to pre-dose levels and demonstrate a reduction depending on the time and dose-dependent protein levels with treatment: with ISIS oligonucleotides. . Table 63 Inhibition of human transthyretin protein in the plasma of transgenic mice with hTTR in relation to the ISslsNno pre-dose levels. —JpDoseímalkay) do —— [aa = Jams | 420 913 25 73
FE 4 a Par EEA and DE e E nn a a So NE a [Re 4 Eos
The Ma Silk 515 6 |
NAN NAC Ear o [141925 26 RS Body weight and organ weight The body weights of the mice were measured pre-dose and at the end of the treatment period. Body weights are shown in Table 64 and expressed as a percentage of increase in weight: 5 PBS control done before the start of treatment. Weights of the liver, "spleen and kidney were measured at the end of the study, and are also shown in Table 64 as a percentage change over the respective weights of the PBS control organs. Table 64 Change in body weights and of the organs of transgenic mice after treatment with antisense oligonucleotide (7%) fe NA E ace aa aa drain
[OT that Tra Te Rm | ode fes
ISIS 420957 25 12.8 EA so E —— ISIS 141923 25 9.2 1.3 20.4 Liver function To assess the effect of ISIS oligonucleotides on liver function, plasma transaminase concentrations were measured using . using an automated clinical chemistry analyzer (Hitachi Olympus' 5 — AU400e, Melville, NY). Plasma concentrations of ALT (Alanine transaminase) and AST (Aspartate transaminase) were measured and the results are shown in Table 65, expressed in IU / L. Plasma bilirubin levels were also measured using the same clinical chemistry analyzer; results are also shown in Table 65 and expressed in mg / dL. Table 65 Effect of treatment with antisense oligonucleotide on metabolic markers in the liver of transgenic mice [| Joosetmara Tactaum [astaum) Trtencnçi | es eo e amo IIS 420913 2 shells ade and o ear there a = 96 legs Tait AST (UI
EE of 42 75 0.14 ISIS 420 922 50 40 170 0.14 4 as ISIS 420 950 | 25 - 7a 116 e & | 4 34 4 TN ISIS 420955 17 0.15 Ps 0.16 4 50 153 017 ISIS 420957 | 25 - 40 8 1 x le: at 37 6: ISIS 420959 | 25 51 92 - 10 - 48 69. 0.13 4 s7 67 ISIS 141928 | 26 Ps Kidney function To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) concentrations were measured using an automated clinical chemistry analyzer (Hitachi Olynpus AU400e, Melville, NY). The results are shown in Table 66, expressed in mg / dL. Table 66 Effect of treatment with antisense oligonucleotide on BUN (mg / dL) in the kidney of transgenic mice
BUN PBs GOOD 24
[ose 4 20 ISIS 420921 25 24 10 2. MEDIA: 4 and ISIS 420922 | 25 - no - 4 - 24 ISIS 420950 28 22 - 10 26 - are 4 23 ISIS 420955 25 ——— Ss e: 4: ISIS 420957 25 "10 9 D ISIS 420959 25: - 22 IIS 141923 Example 21: Confirmation of dose response of antisense oligonucleotides targeting human transthyretin in primary monkey hepatocytes cynomolgus Gapmers showing tolerability in CD1 mice and Sprague Dawley rats (studies described in Examples 17-19), as well as potency in transgenic mice (studies described in Examples 16 and 20) were selected and tested in various doses on primary hepatocytes of cynomolgus monkeys.
The cells were plated at a density of 35,000 cells per well and transfected using electroporation with concentrations of the antisense oligonucleotide of 156.25 nM, 312.5 nM,
625 nM, 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM, and 20,000 nM, as specified in Table 67. After a treatment period of about 16 hours, RNA was isolated from the cells and the MRNA levels of the disorder - retina were measured by quantitative real-time PCR. The human primer set RTS1396 was used to measure transthyretin MRNA levels. Transthyretin mRNA levels were adjusted according to the total RNA content, measured by RIBOGREEN. The results are presented as a percentage of transthyretin inhibition in relation to untreated control cells. As shown in Table 67, transthyretin mMRNA levels were reduced in a dose-dependent manner in hepatocytes treated with all ISIS oligonucleotides, which cross-react with the rhesus monkey transthyretin gene, referred to here as SEQ ID NO: 4 (exons 1-4 taken from GENBANK NW No. 001105671.1).
: 15 Table67 f Dose-dependent inhibition of human transthyretin antisense. na in primary hepatocytes of cynomolgus monkey using electroporation ISIS 312.5 1250 5000 No. nM nM nM nM nM nM nM [50209 jo - o 2 ss les | lazosis “the air to 866 the jo | (men o e er ae lo 1st half o E Bo o oo
PEN | azonss 16 Jo only 17% of | ie de dae dede "if lo
Table 67- continued- 14 504 ss 12 20015 - o bh o7 s12 420922 NE 2.9 420950 os 420955 97 14 584 [1220056 - aa 15 586 Example 22: Measurement of the viscosity of ISIS antisense oligonucleotides targeting human transthyretin The viscosity The antisense oligonucleotides from the EF 5 studies described in Example 21 were measured with the aim of screening antisense - oligonucleotides that have a viscosity greater than 40 cP.
The | oligonucleotides with viscosity greater than 40 cP would be too viscous to be administered to any subject.
ISIS oligonucleotides (32-35 mg) were weighed in a glass bottle, 120 µl of water was added and the antisense oligonucleotide was dissolved in the solution by heating the bottle to 50 ° C.
Part (75 µl) of the preheated sample was pipetted into a micro-viscometer (Cambridge). The temperature of the micro-viscometer was set at 25ºC and the viscosity of the sample was measured.
Another part (20 ul) of the preheated sample was pipetted in 10 ml of water for UV reading at 260 nm at 85ºC (Cary UV instrument). The results are shown in Table 68 and indicate that all solutions of the antisense oligonucleotides showed optimal viscosity under the criteria indicated above.
Table 68 Viscosity and concentration of ISIS antisense oligonucleotides targeting human transthyretin
ISIS No, Concentration (mg / mL) BC AR fo 420955 15.7 259 E fi E Example 23: Measurement of the antisense oligonucleotide half-life in the liver of the CD1 mouse CD1 mice were treated with the ISIS antisense oligonucleotides from the ISIS studies described in Example 22 and the half-life of the oligonucleotide as well as the time taken for the oligonucleotide to be degraded and eliminated from the liver was assessed.
Treatment. Groups of twelve CD1 mice were injected subcutaneously twice a week for 2 weeks with 50 mg / kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, and ISIS 420959. Four mice of each group was sacrificed 3 days, 28 days and 56 days followed by the final dose.
Livers were harvested for analysis.
Measurement of oligonucleotide concentration The concentration of the complete oligonucleotide, as well as the total concentration of the oligonucleotide (including the degraded form) was measured.
The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consists of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction.
An internal standard (ISIS 355868, a modified 27-mer2'-O-methoxyethyl phosphorotic oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTIT, designated here as SEQ ID NO: 166) was added prior to extraction.
Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantification (LLOQ) of approximately 1.14
Vp9 / g.
Half-lives were calculated using the WinNonlin (PHARSIGHT) software. The results are shown in Table 69, expressed as V9 / g of liver tissue.
The half-life of each of the oligonucleotides is shown in Table 70. Table 69 Concentration of the full-length oligonucleotide (ug / g) in the liver of mice CD1 420913 243 33; 420957 129 49 Table 70 Oligonucleotide half-life (days) in the liver of CD1 ISIS mice No, Half-life (Days) 420921 10.0 Example 24: Effect of ISIS antisense oligonucleotides directed to human transthyretin in cynomolgus monkeys Cynomolgus monkeys were treated with oligonucleotides — ISIS antisense from the studies described in Examples 21, 22 and 23. The tolerability and efficacy of the antisense oligonucleotide, as well as its pharmacokinetic profile in the liver and kidneys, were assessed.
Treatment Before the study, monkeys were quarantined for a period of 30 days, during which standard panels of serum chemistry and hematology, examination of fecal samples for eggs and parasites, and a tuberculosis test, were conducted to filter out abnormal or sick monkeys.
Nine groups of four randomly assigned male cynomolgus monkeys were injected subcutaneously three times a week during the first week, and subsequently twice a week for the next 11 weeks, with 25 mg / kg of ISIS 304299, ISIS 420915 , ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS 420959. A control group of 4 cynomolgus monkeys was injected with PBS subcutaneously three times a week during the first week, and subsequently twice per week for the next 11 weeks.
Blood samples were collected 5 days before treatment. 15 ment, as well as on several days of the study period and analyzed.
The animals were fasting for at least 13 hours (one night) before. blood collection.
Terminal sacrifices of all groups were performed on day 86, which was 48 hours after the last dose.
During the study period, monkeys were observed daily for signs of illness or distress.
Any animal showing adverse effects to the treatment was removed and sent to the veterinarian and Study Director.
All animals treated with ISIS 420955 were removed from the study on day 31 due to the disease symptoms indicated by 2 monkeys in the group.
Likewise, a monkey from each of the groups treated with ISIS 420957 and ISIS 420950 was removed from the study on days 44 and 76, respectively, due to signs of illness.
Inhibition studies RNA analysis On day 86, RNA was extracted from liver tissue for analysis of transthyretin by real-time PCR using the RTS3029 primer set. The results are presented as a percentage of inhibition of human transthyretin, in relation to the PBS control, normalized to cyclophylline. Similar results were obtained in normalization with RI-BOGREEN º. As shown in Table 71, treatment with ISIS antisense oligonucleotides resulted in a significant reduction in human transthyretin MRNA compared to the PBS control. Specifically, treatment with ISIS 420915 caused greater inhibition of TTR MRNA than treatment with ISIS 304299, even though the two oligonucleotides differed by a single base pair displacement. Data for animals treated with ISIS 420955 were taken on day 31. Table 71 Inhibition of transthyretin mRNA in the liver of a cyano-molgus monkey in relation to the PBS control 304299 59: at 420950 91 == (“Date of day 31) Protein analysis Monkeys were fasted overnight before blood was collected. Approximately 1 mL of blood was collected from all available animals and placed in tubes containing the EDTA potassium salt. The tubes were centrifuged (3000 rpm for 10 min at room temperature) to obtain the plasma. Transthyretin protein levels were measured in plasma using a clinical analyzer. Plasma samples were extracted pre-dose (on day -5) and on days 1, 9, 16, 23, 30, 44, 58.72 and
86. The results are shown in Table 72 expressed as a percentage of inhibition compared to the pre-dose levels and demonstrate a time-dependent reduction in protein levels with treatment with ISIS oligonucleotides. The final levels of plasma TTR are shown
shown in Table 73 and demonstrate the strong correlation between the reduction in the level of TTR protein and the inhibition of TTR MRNA (Table 71). Specifically, treatment with ISIS 420915 caused greater inhibition of plasma TTR protein than treatment with ISIS 304299 (76% inhibition compared to 47% inhibition), even if the two oligonucleotides differed by a single displacement base pair.
Table 72 Time course of reduction in the level of transthyretin protein in the plasma of the cynomolgus monkey in relation to the pre-dose levels ISIS No. Day 9 | Day Day Day Day Day Day Day 16 23 30 44 58 72 86 15 21 | 23 ja | 27 | 2095 8 SS 76 E ation 1 E) 20922 o & sa 2 Es re 158 87: 420955 2 ions 420957 18 26 | 26 ko: 420050 jo [25 [20 [26 | & 4 so n / a = study has ended on day 31 of animals treated with ISIS 420955; therefore data for subsequent days are not available.
Table 73 Reduction of the level of transthyretin protein of day 86 in the plasma of the cynomolgus monkey in relation to the pre-dose ISIS No.% reduction - 304299 47 420918 420921 420922 54 420950 87 420957 50 - 420959 - 50 RBP4 protein levels were also measured in plasma using an ELISA kit.
Plasma samples were extracted pre-dose (on day -5) and on days 9, 16, 23, 30, 44, 58, 72 and 86. The results are shown in Table 74 expressed as the percentage of inhibition compared - compared to pre-dose levels.
Some of the ISIS oligonucleotides (ISIS 420915, ISIS 420922, ISIS 420950, ISIS 420955 and ISIS 420959) demonstrate a time-dependent reduction in protein levels, concomitant with the reduction in TTR.
The final plasma RBP4 levels are shown in Table 75 and also demonstrate the strong correlation between the reduction in the levels of RBP4 and TTR proteins (table 73) in the treatment with the oligonucleotides mentioned above.
Specifically, treatment with | - SIS 420915 caused greater inhibition of plasma RBP4 protein than treatment with ISIS 304299 (63% inhibition compared to 19% inhibition), even though the two oligonucleotides differed by a single base pair offset.
Table74: Time-lapse of the reduction in the level of RBP4 protein in «monkey cynomolgus plasma in relation to pre-dose levels [issno [Das [na16] na2s [Das0 Das [na se [Da 7a seia le le lute h lo Je le 20915 fat and fe de fe je tee le [a20s2a 1a fas [16 of the 26 15 | & [azosss and 136 | so Jos (ma [ma (ma | ma | stool lo ee la oe ls lar n / a = study was closed on day 31 of animals treated with ISIS 420955, so data for subsequent days are not available.
Table75 Reduction of RBP4 protein level on day 86 in the plasma of monkey cynomolgus in relation to pre-dose levels
420957 27 - 420959 - 34 Tolerability studies Body and organ weight measurements To assess the effect of ISIS oligonucleotides on the general health of the animals, body and organ weights were measured on day 86. Data for animals treated with ISIS 420955 were taken on the day
31. Body weights were measured and compared to those in the numbers. pre-dose. The organ weights were measured and the weights of the treatment group were compared with the corresponding weights of the PBS control. The data are presented in Table 76. Table76 Changes in% of the final body and organ weight in the cynomolgus monkey in relation to the pre-dose levels ISISNº Liver Weight ”s7 o +166 se le le der der Rae am (“ Date of day 31)
Liver function To assess the effect of ISIS oligonucleotides on liver function, blood samples were collected from all study groups.
Blood samples were collected in tubes without any anticoagulants for serum separation.
The tubes were kept at room temperature for 90 minutes and then centrifuged (3000 RPM for 10 minutes at room temperature) to obtain the serum.
Transaminase concentrations were measured using a Toshiba 200FR NEO chemical analyzer (Tokyo Shiba Co., Japan). Plasma concentrations of ALT (Alanine transaminase) andAST (Aspartate transaminase) were measured on day 86 and the results are shown in Table 77, expressed in IU / L.
Alkaline phosphatase, which is synthesized in greater quantities by compromised liver cells, is also a marker of liver disease and was measured in the same way.
C-reactive protein (CRP), which is synthesized in the liver and which: 15 serves as an inflammation marker, was also measured in a similar way. on day 86. Alkaline phosphatase and CRP data are also shown <in Table 77. Bilirubin is also a metabolic marker of the liver and was: also measured and shown in Table 77, expressed in mg / dL.
Table 77 Effect of antisense olignucleotide treatment on labeled. metabolic factors of the liver in monkey plasma cynomolgus ALT (IU / L) Bilirubin o mall) | (mg / dL) Pes e lee in les los isissaosis les = or dem = 16 los (ss cen la ar e aa e 1818 420922 ss
Kidney function To assess the effect of ISIS oligonucleotides on liver function, blood samples were collected from all study groups. Blood samples were collected in tubes without any anticoagulants for serum separation. The tubes were kept at room temperature for 90 minutes and then centrifuged (3000 RPM for 10 minutes at room temperature) to obtain the serum. BUN and creatine concentrations were measured on day 86 using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). The results are presented in Table78, expressed in mg / dL.
Urine samples were collected by draining special stainless steel trays from the cage on day 5 before the study and later on days 25 and 84. The ratio of total protein to urinary creatinine was measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan) and the results are shown in Table 79.
- Table 78 - Effect of antisense oligonucleotide treatment on levels: plasma BUN and creatinine (mg / dL) in cynomolgus monkeys BUN Creatinine PBS 28 0.86 ISIS 304299 27: 0.85. ISIS 420915 25 0.90 33 0.8 28 0.86 ISIS 420950 0.97 ISIS 420957 ISIS 420959 0.89 Table 79 Effect of antisense oligonucleotide treatment on protein and urinary creatinine ratio in cynomolgus monkeys
0.003 0.00
0.000 oo low
0.003 lo oo - | ISIS 420921 0.033 0.098 ISIS 420922 0.010 0.02 ISIS420950 - 0.008 0.21 à. ISIS 420955 0.000 blonde —— ISIS 420957 0.000 0.48 0.36 0.005 0.08 0.03 n / a = study ended on day 31 for animals treated with ISIS 420955; therefore data for subsequent days are not available. Hematology To assess any inflammatory effects of 1- - 5 SIS oligonucleotides in cynomolgus monkeys, samples of approximately 0.5 mL of Õ blood were collected from each of the study animals available in O tubes containing EDTA potassium salt. The samples were analyzed for red blood cell count (RBC), white blood cells (WBC), percentages of white blood cells, such as those for monocytes, neutrophils, lymphocytes, as well as for platelet and hematocrit counts ( %), using an ADVI-A120 hematology analyzer (Bayer, USA). The data are shown in Table 80.
Ê o 2 nl sis Sis col = | o o and co) e] | E = -) es a as] Nr o o o
S> = Bl 8 | 2 ss Sis
E Ru Ru qa + So Fo gléE Ss SS S [8 Sole o
SI oi Ss eo) o s $ | 2 2/53 = e E E a qo an =) a o | o rm Oi o 16 / (o <= o e o is Es Ce a - a = 8 SS Fono o rosa 2 XT) FS SS and Ss o ss. al: <º
FSB el E e e 33> o | gg o o o a o o o o O) E OS | o co O O oO oO) BD A e) vo O O o adao Ss sl “o =
E o> - Si os O mS OA al = a a gs) m o o O O | xe es) sf ae) a) OS AND BEAST
And s
S so = SET ess 23 == = them o à So = | a o Nr o S | = al o io o a O oO o o o o Ss v / SO) SO) O O) O) So o) o! a a a aa aa Ss Ol E Tv Tv sv 7 | WRITING AR NARCRA | And o o o) o 7 oo is 2) O) Oyo | O)"
225/232 | Inflammation factors analysis To assess the effect of ISIS oligonucleotides on the factors involved in inflammation, blood was collected on day 86 from all animals available for complement C3 analysis, as well as for measuring cytokine levels . For the complement C3 analysis, blood samples were collected in tubes without any anticoagulants for serum separation. The tubes were kept at room temperature for 90 minutes and then centrifuged (3000 RPM for 10 minutes at room temperature) to obtain the serum. Complement C3 was measured using an automatic analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co., Japan). The data are shown in Table 81, expressed in mg / dL.
For cytokine level analysis, blood was collected in tubes containing EDTA for plasma separation. The tubes were then centrifuged (3000 rpm for 10 min at room temperature) to obtain the plasma. Plasma samples were sent to Aushon Biosystems Inc. (Bille- rica, MA) for measurement of chemokine and cytokine levels. - TNF-a levels were measured using the respective primate antibodies and the levels of MIP-1a, MCP-1, and MIP-13 were measured using the respective human cross-reactive antibodies. Measurements were taken 5 days before the start of treatment and on days 3 and 86. The results are shown in Tables 82-85.
Table 81 Effect of antisense oligonucleotide treatment on complement C3 (mg / dL) in cynomolgus monkeys THE
EE 1615 420015 sans Bt Ens is |
Table 82 Effect of antisense oligonucleotide treatment on MCP-1 (pg / mL) in cynomolgus monkeys | PBS 206 Healthy ISIS 420915 204 342 400 ISIS 420921 281 407 - ISIS 420922 215 482 ISIS 420957 208 3485 ISIS 420959 715 2035 - Table 83 Ss Effect of antisense oligonucleotide treatment on TNF-a n (pg / mL) in cynomolgus monkeys: PBS [6 and 6
ISIS 420921 s7 50 56 48 54 266 ISIS 420957 Table 84 Effect of antisense oligonucleotide treatment on MIP-1a (pg / mL) in cynomolgus monkeys Bs de oro [bake 6 es ess Team —— [legs E to E EA IsIs420067 - | 6 Ee lisazaso ia te ds Table 85 Effect of antisense oligonucleotide treatment on MIP-13 (Pg / mL) in cynomolgus gs monkeys - Dia3 PBs 42 54 7 as. 9 70 ssa a as 126 É 27 182 Coagulation tests To assess the effect of ISIS oligonucleotides on the factors involved in the coagulation pathway, standard coagulation tests were used.
PT and aPTT were measured using monkey platelet poor plasma (PPP) over a 48 hour period.
PT and aPTT values are given in Tables 86 and 87 and expressed in seconds.
Plasma fibrinogen levels were also quantified over a period of 48 hours and the data are shown in Table 88. As shown in Tables 86-88, PT, aPTT and fibrinogen were not significantly changed in monkeys treated with ISIS oligonucleotides, compared with PBS control.
Table86 | Effect of antisense oligonucleotide treatment on PT (s)
SEAT ra Sr NA ISIS 420915 10.13 9.75 | ISIS 420922 995 - 10.00 | 1005 joas 928 ea ana Tica, 10.57 9.50 ISIS 420957 [10.68 1047 10.60 10.27 eae eoeoE 1000 10.20 [1015 j980 Table 87
Effect of antisense oligonucleotide treatment on aPTT (s)
oh 1h 4h 24h [agn
PBS [1940 [1970 [2013 [2020 [1943 17.30 ISIS 420915 [20.05 / 2283 2383 & 1818 420921 [2415 [2668 | 3178 | 31.90 ISIS 420922 | 25.28 2948 [34.83 | 33, 90: ISIS 420950 [2813/3140 3540 | 3540 | 31.40 ISIS 420957 [20.13 3327 3913 3740 36.50 ISIS 420950 [2245 [2473 | 2918 j2838 | 25.50
Table 88 Effect of antisense oligonucleotide treatment on fibrinogen (ma / dl)
[isis a20027 [208 200 [250 200 ISS 420067 1280. | 200
Thyroid panel analysis To assess the effect of ISIS oligonucleotides on thyroid hormones, monkeys were fasted overnight and 3.5 mL of blood was drawn from each of the animals available in the study 5 days before the start of treatment and on days 51 and 86. The blood samples were kept in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 minutes, and then they were centrifuged (3000 rpm for 10 minutes at room temperature) to obtain the serum. Serum samples were sent to the Core Biomarkers Laboratory at Emory University (Atlanta, GA) for thyroid panel analysis. The results for thyroid stimulating hormone (TSH) are given in Table 89 and expressed in uplL / mL. The results for the total and free hormone T3 are provided in Tables 90 and 91. The results for the total and free hormone T4 are provided in Tables 92 and
93. In general, thyroid panel analysis showed that all animals —- remained within acceptable hormone levels even though transthyretin expression levels were reduced, demonstrating that transthyretin antisense oligonucleotides did not affect levels hormonal. Table 89 Effect of the treatment of antisense oligonucleotide on TSH (pL / mL) [O es o Test nas Is das er ne 22 or los lisisaenees no - he o [sis4z20050 Cos 22 [o | Table 47 Effect of antisense oligonucleotide treatment on total T3
(ng / dL) Day -5 Day 51 Day 86 PBS 177 248 140 226 Te 206 fans 217 204 137 ISIS 420922 188 dr 131 ISiISs420050 - | 260 208 of ISsis420057 - | 266 th ——— Isis4209595 - [299 | 219 137 Table 91 Effect of antisense oligonucleotide treatment on free T3 (pg / mL) Day -5 Day 51 Day 86. ISIS 304299 6.0 47 Y ISIS 420915 8.9 5.6 45 ISIS 420921 10.2 ab 4.0 Tabelag2 Effect of antisense oligonucleotide treatment on total T4 (ng / dL) Day-5 Day 51 Day 86 PBS 5, 8 4.9 4.4 1618 420021 si [ESC
Table 93 Effect of antisense oligonucleotide treatment on free T4 (pg / ml)
EEE PBS 3.4 17 25 aa ISIS 420 915 5.0 18 A ISIS 420 921 26 1.5 15 ISIS 420 922 3.5 1.6 15 ISIS 420 950 2.5 12 1H ISIS 420 957 24 12 TV 3.8 14 5 Pharmacokinetic studies Measurement of oligonucleotide concentration "o The concentration of the complete oligonucleotide, as well as the total concentration of the oligonucleotide (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996 ; Geary et al., 1999) which consists of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction An internal standard (ISIS 355868, a modified 27-mer 2 - O- phosphorothioate oligonucleotide methoxyethyl, GCCGTTTGCTCTTCTTCTTGCGTTITIT, here referred to as SEQ ID NO: 166) was added prior to extraction.The tissue sample concentrations were calculated using calibration curves, with a lower quantitation limit (LLOQ) of approximately 1.14 vog / The ratio between kidney and liver concentrations was calculated. The results are shown in Tables 94 and 95, expressed as g / g of tissue. Table 94 Concentration of the full-length oligonucleotide (ug / g) in the liver of cynomolgus monkeys |
[sine - Rm Jrigado - [Reaction RimFigado | 2nd 23 1521 - 30
2921 38 2444 1111 22 3619 29 420959 3918 1158 34 Table 95 Total concentration of the oligonucleotide (ug / g) in the liver of monkey cynomolgus ISIS No. Kidney / Liver Ratio 304299 eo 420915 420921 1974 31: 420922 141 420950 1553 420967 34 420959 5498

权利要求:
Claims (25)
[1]
1. Compound, characterized by the fact that it comprises a modified o-ligonucleotide consisting of 12 to 30 linked nucleosides, in which the linked nucleosides have a sequence of nucleobases comprising: (a) a sequence described in SEQ ID NO: 80, 86, 87, 115, 120, 122 or 124; (b) at least 15 contiguous nucleobases of a sequence described in SEQ ID NO: 120, 122 or 124; or (c) at least 18 contiguous nucleobases of a sequence described in SEQ ID NO: 87, 120, 122 or 124.
[2]
A compound according to claim 1, characterized by the fact that the modified oligonucleotide consists of 15 to 25 linked nucleosides.
[3]
A compound according to claim 1, characterized by the fact that the modified oligonucleotide consists of 18 to 21 linked nucleosides.
[4]
A compound according to claim 1, characterized by the fact that the modified oligonucleotide consists of 20 linked nucleosides.
[5]
Compound according to any one of claims 1 to 4, characterized in that the modified oligonucleotide is a single-stranded oligonucleotide.
[6]
A compound according to any one of claims 1 ab, characterized in that the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO 1.
[7]
Compound according to any one of claims 1 to 5, characterized in that the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to SEQ ID NO 1.
[8]
A compound according to any one of claims 1 to 5, characterized in that the nucleobase sequence of the modified oligonucleotide is at least 100% complementary to SEQ ID NO 1.
and)
[9]
Compound according to any one of claims 1 to 8, characterized in that at least one internucleoside bond is a modified internucleoside bond.
[10]
A compound according to claim 9, characterized by the fact that each internucleoside bond is an internucleoside phosphorothioate bond.
[11]
A compound according to any one of claims 1 to 10, characterized in that the at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
[12]
12. A compound according to claim 11, characterized by the fact that at least one modified sugar is a bicyclic sugar.
[13]
A compound according to claim 12, characterized in that the at least one bicyclic sugar comprises a 4 '- (CH2) -0-2', 4 '- (CH2) 2-0-2' bridge, or 4-CH (CH3) -0-2 ".
[14]
Compound according to claim 11, characterized in that at least one modified sugar comprises a 2'-O-methoxyethyl group.
[15]
A compound according to any one of claims 1 to 14, characterized in that the at least one nucleoside comprises a modified nucleobase.
[16]
16. A compound according to claim 15, characterized in that the modified nucleobase is a 5-methylcytosine.
[17]
A compound according to any one of claims 1 to 16, characterized in that the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides | a 5 'flanking segment consisting of linked nucleosides; and a 3 'flanking segment consisting of linked nucleosides; where the interval segment is positioned between the
flanking element 5 'and the flanking segment 3' and in which each nucleoside of each flanking segment comprises a modified sugar.
[18]
18. A compound according to claim 17, characterized in that the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5 'flanking segment consisting of five linked nucleosides; and a 3 'flanking segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 'flanking segment and the 3' flanking segment, where each nucleoside of each flanking segment comprises a 2'-O-methoxyethyl sugar; and where each internucleoside bond is a phosphorothioate bond, and where each cytosine is 5-methylcytosine.
[19]
19. Compound, characterized by the fact that it comprises a single-stranded modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of the sequence described in SEQ ID NO: 80, in which the oligonucleotide comprises: a gap segment that it consists of ten linked deoxynucleosides; a 5 'flanking segment consisting of five linked nucleosides; and a 3 'flanking segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 'flanking segment and the 3' flanking segment, where each nucleoside of each flanking segment comprises a 2'-O-methoxyethyl sugar; and where each internucleoside bond is a phosphorothioate bond, and where each cytosine is 5-methylcytosine.
[20]
20. Composition, characterized in that it comprises the compound as defined in any one of claims 1 to 19, or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
[21]
21. Use of a compound or composition, as defined (a) in any of claims 1 to 20, characterized by the fact that it is in the manufacture of a medicament to prevent, treat, improve or delay the progression of transthyretin amyloidosis.
[22]
22. Use of a compound or composition, as defined (a) in any of claims 1 to 20, characterized by the fact that it is in the manufacture of a medicament to reduce the expression of mRNA or transthyretin protein in a tissue or cell human.
[23]
23. Use of a compound or composition, as defined (a) in any of claims 1 to 20, characterized by the fact that it is in the manufacture of a medication to reduce a symptom associated with transthyretin amyloidosis selected from the group consisting of restlessness , lack of coordination, nystagmus, spastic paraparesis, lack of muscle coordination, visual impairment, insomnia, unusual sensations, myoclonus, blindness, loss of speech, carpal tunnel syndrome, attacks, subarachnoid hemorrhages, stroke and hemorrhage in brain, hydrocephalus, ataxia and spastic paralysis, coma, sensory neuropathy, paratesia, hypoesthesia, motor neuropathy, autonomic neuropathy, orthostatic hypotension, cyclic constipation, cyclic diarrhea, nausea, vomiting, reduced sweating, impotence, delayed gastric emptying , urinary retention, urinary incontinence, progressive heart disease, fatigue, difficulty breathing, weight loss, lack of appetite, numbness, tingling, weakness, macroglossia, nephrotic syndrome, congestive heart failure, dyspnoea on exertion, peripheral edema, arrhythmias, palpitations, dizziness, syncope, postural hypotension, peripheral nerve problems, motor sensory deficiency, lower limb neuropathy, neuropathy of limbs hyperalgesia, sensation of altered temperature, weakness of the lower extremity, cachexia, peripheral edema, hepatomegaly, purple, diastolic dysfunction, premature ventricular contractions, cranial neuropathy, reduced reflexes of the deep tendon, amyloid deposits in the vitreous body glassy opacity,
dry eyes, glaucoma, curved appearance in the pupils, or swelling of the feet due to water retention in humans.
[24]
24. Method for treating transthyretin amyloidosis in an animal, characterized by the fact that it comprises the administration to the animal of the compound or composition, as defined (a) in any one of claims 1 to 20.
[25]
25. Invention, in any form of its embodiments or in any applicable category of claim, for example, of product or process or use encompassed by the matter initially described, revealed or illustrated in the patent application.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112012027547A2|2020-10-13|COMPOUND UNDERSTANDING OLIGONUCLEOTIDE, COMPOSITION, AND ITS USES TO PREVENT TREAT, IMPROVE, OR SLOW DOWN PROGRESSION OF TRANSYSTERRETIN AMYLOIDOSIS OR TO REDUCE THE EXPRESSION OF MRNA OR TRANSTRETREIN PROTEIN

---

ES2762326T3|2020-05-22|Methods to modulate the expression of C9ORF72

---

ES2756326T3|2020-04-27|Modulation of myotonic dystrophy-protein kinase | expression

---

ES2733708T3|2019-12-02|Selective reduction of allelic variants

---

RU2662967C2|2018-07-31|Modulators of complement factor b

---

RU2690333C2|2019-05-31|Compounds and methods for modulating expression of dystrophic miotonin-proteinkinase |

---

BR112012005448A2|2020-08-18|compound, composition comprising said compound and uses thereof

---

US20110237646A1|2011-09-29|Modulation of transthyretin expression for the treatment of cns related disorders

---

ES2790574T3|2020-10-28|Prekallikrein expression modulation |

---

CA2865468C|2021-05-04|Methods of treating cancer by inhibition of dna repair proteins

---

BR112020016001A2|2020-12-15|IRF4 EXPRESSION MODULATORS

---

BR112020018698A2|2021-01-05|EZH2 EXPRESSION MODULATORS

---

JP2021500903A|2021-01-14|Regulator of ENaC expression

---

AU2016203300B2|2017-04-13|Modulation of transthyretin expression

---

CA3135579A1|2020-10-08|Compound, method and pharmaceutical composition for modulating expression of dux4

---

BR112021004859A2|2021-06-08|pnpla3 expression modulators

同族专利:

---

公开号 | 公开日

---

NL300963I9|2019-01-16|

---

EP2563920A4|2014-11-12|

---

MX2012012624A|2013-05-06|

---

IL222697D0|2012-12-31|

---

LTC2563920I2|2020-10-12|

---

NO2019001I1|2019-01-04|

---

PT2563920T|2017-05-26|

---

US9399774B2|2016-07-26|

---

US20140256797A1|2014-09-11|

---

US20210095281A1|2021-04-01|

---

WO2011139917A1|2011-11-10|

---

KR20180026798A|2018-03-13|

---

EP2563920A1|2013-03-06|

---

US20180273946A1|2018-09-27|

---

US20150252367A1|2015-09-10|

---

CN103038345A|2013-04-10|

---

RU2592669C2|2016-07-27|

---

HRP20170737T1|2017-07-28|

---

LUC00096I1|2019-01-07|

---

CA2994063A1|2011-11-10|

---

DK2563920T3|2017-05-22|

---

US9061044B2|2015-06-23|

---

JP5896175B2|2016-03-30|

---

ES2625689T3|2017-07-20|

---

RU2012150394A|2014-06-10|

---

US20160369275A1|2016-12-22|

---

IL222697A|2017-05-29|

---

CN103038345B|2017-07-21|

---

JP2013526860A|2013-06-27|

---

LUC00096I2|2021-04-14|

---

CA2797792C|2018-02-27|

---

SI2563920T1|2017-05-31|

---

HUE031909T2|2017-08-28|

---

EP2563920B1|2017-03-15|

---

RS56011B1|2017-09-29|

---

PL2563920T3|2017-08-31|

---

CY1119070T1|2018-01-10|

---

CA2797792A1|2011-11-10|

---

LT2563920T|2017-05-25|

---

LTPA2019001I1|2019-01-25|

---

US8697860B1|2014-04-15|

---

HUS1900001I1|2019-01-28|

---

US20190169613A1|2019-06-06|

---

US9816092B2|2017-11-14|

---

KR101835386B1|2018-03-08|

---

KR20130098162A|2013-09-04|

---

NL300963I1|2019-01-08|

---

NZ603339A|2015-01-30|

---

MX343559B|2016-11-10|

---

US20110294868A1|2011-12-01|

---

NL300963I2|2021-03-08|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US2699808A|1944-10-06|1955-01-18|Mark W Lowe|Apparatus for peeling tomatoes|

---

US2699508A|1951-12-21|1955-01-11|Selectronics Inc|Method of mounting and construction of mounting for low frequency piezoelectric crystals|

---

US3687808A|1969-08-14|1972-08-29|Univ Leland Stanford Junior|Synthetic polynucleotides|

---

US4469863A|1980-11-12|1984-09-04|Ts O Paul O P|Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof|

---

US4534899A|1981-07-20|1985-08-13|Lipid Specialties, Inc.|Synthetic phospholipid compounds|

---

US4426330A|1981-07-20|1984-01-17|Lipid Specialties, Inc.|Synthetic phospholipid compounds|

---

US5023243A|1981-10-23|1991-06-11|Molecular Biosystems, Inc.|Oligonucleotide therapeutic agent and method of making same|

---

US4476301A|1982-04-29|1984-10-09|Centre National De La Recherche Scientifique|Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon|

---

JPH0372639B2|1982-08-09|1991-11-19|Wakunaga Seiyaku Kk|

---

FR2540122B1|1983-01-27|1985-11-29|Centre Nat Rech Scient|NOVEL COMPOUNDS COMPRISING A SEQUENCE OF OLIGONUCLEOTIDE LINKED TO AN INTERCALATION AGENT, THEIR SYNTHESIS PROCESS AND THEIR APPLICATION|

---

US4605735A|1983-02-14|1986-08-12|Wakunaga Seiyaku Kabushiki Kaisha|Oligonucleotide derivatives|

---

US4948882A|1983-02-22|1990-08-14|Syngene, Inc.|Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis|

---

US4824941A|1983-03-10|1989-04-25|Julian Gordon|Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems|

---

US4587044A|1983-09-01|1986-05-06|The Johns Hopkins University|Linkage of proteins to nucleic acids|

---

US5118802A|1983-12-20|1992-06-02|California Institute Of Technology|DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside|

---

US5118800A|1983-12-20|1992-06-02|California Institute Of Technology|Oligonucleotides possessing a primary amino group in the terminal nucleotide|

---

US5550111A|1984-07-11|1996-08-27|Temple University-Of The Commonwealth System Of Higher Education|Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof|

---

FR2567892B1|1984-07-19|1989-02-17|Centre Nat Rech Scient|NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS|

---

US5367066A|1984-10-16|1994-11-22|Chiron Corporation|Oligonucleotides with selectably cleavable and/or abasic sites|

---

US5258506A|1984-10-16|1993-11-02|Chiron Corporation|Photolabile reagents for incorporation into oligonucleotide chains|

---

US5430136A|1984-10-16|1995-07-04|Chiron Corporation|Oligonucleotides having selectably cleavable and/or abasic sites|

---

US4828979A|1984-11-08|1989-05-09|Life Technologies, Inc.|Nucleotide analogs for nucleic acid labeling and detection|

---

FR2575751B1|1985-01-08|1987-04-03|Pasteur Institut|NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS|

---

US5185444A|1985-03-15|1993-02-09|Anti-Gene Deveopment Group|Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages|

---

US5034506A|1985-03-15|1991-07-23|Anti-Gene Development Group|Uncharged morpholino-based polymers having achiral intersubunit linkages|

---

US5166315A|1989-12-20|1992-11-24|Anti-Gene Development Group|Sequence-specific binding polymers for duplex nucleic acids|

---

US5405938A|1989-12-20|1995-04-11|Anti-Gene Development Group|Sequence-specific binding polymers for duplex nucleic acids|

---

US5235033A|1985-03-15|1993-08-10|Anti-Gene Development Group|Alpha-morpholino ribonucleoside derivatives and polymers thereof|

---

US4762779A|1985-06-13|1988-08-09|Amgen Inc.|Compositions and methods for functionalizing nucleic acids|

---

US5317098A|1986-03-17|1994-05-31|Hiroaki Shizuya|Non-radioisotope tagging of fragments|

---

JPS638396A|1986-06-30|1988-01-14|Wakunaga Pharmaceut Co Ltd|Poly-labeled oligonucleotide derivative|

---

EP0260032B1|1986-09-08|1994-01-26|Ajinomoto Co., Inc.|Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers|

---

US5276019A|1987-03-25|1994-01-04|The United States Of America As Represented By The Department Of Health And Human Services|Inhibitors for replication of retroviruses and for the expression of oncogene products|

---

US5264423A|1987-03-25|1993-11-23|The United States Of America As Represented By The Department Of Health And Human Services|Inhibitors for replication of retroviruses and for the expression of oncogene products|

---

US4904582A|1987-06-11|1990-02-27|Synthetic Genetics|Novel amphiphilic nucleic acid conjugates|

---

DE3851889T2|1987-06-24|1995-04-13|Florey Howard Inst|NUCLEOSIDE DERIVATIVES.|

---

US5585481A|1987-09-21|1996-12-17|Gen-Probe Incorporated|Linking reagents for nucleotide probes|

---

US4924624A|1987-10-22|1990-05-15|Temple University-Of The Commonwealth System Of Higher Education|2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof|

---

US5188897A|1987-10-22|1993-02-23|Temple University Of The Commonwealth System Of Higher Education|Encapsulated 2',5'-phosphorothioate oligoadenylates|

---

US5525465A|1987-10-28|1996-06-11|Howard Florey Institute Of Experimental Physiology And Medicine|Oligonucleotide-polyamide conjugates and methods of production and applications of the same|

---

DE3738460A1|1987-11-12|1989-05-24|Max Planck Gesellschaft|MODIFIED OLIGONUCLEOTIDS|

---

US5403711A|1987-11-30|1995-04-04|University Of Iowa Research Foundation|Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved|

---

EP0348458B1|1987-11-30|1997-04-09|University Of Iowa Research Foundation|Dna molecules stabilized by modifications of the 3'-terminal phosphodiester linkage and their use as nucleic acid probes and as therapeutic agents to block the expression of specifically targeted genes|

---

US5082830A|1988-02-26|1992-01-21|Enzo Biochem, Inc.|End labeled nucleotide probe|

---

EP0406309A4|1988-03-25|1992-08-19|The University Of Virginia Alumni Patents Foundation|Oligonucleotide n-alkylphosphoramidates|

---

US5278302A|1988-05-26|1994-01-11|University Patents, Inc.|Polynucleotide phosphorodithioates|

---

US5109124A|1988-06-01|1992-04-28|Biogen, Inc.|Nucleic acid probe linked to a label having a terminal cysteine|

---

US5216141A|1988-06-06|1993-06-01|Benner Steven A|Oligonucleotide analogs containing sulfur linkages|

---

US5175273A|1988-07-01|1992-12-29|Genentech, Inc.|Nucleic acid intercalating agents|

---

US5262536A|1988-09-15|1993-11-16|E. I. Du Pont De Nemours And Company|Reagents for the preparation of 5'-tagged oligonucleotides|

---

US5194599A|1988-09-23|1993-03-16|Gilead Sciences, Inc.|Hydrogen phosphonodithioate compositions|

---

US5512439A|1988-11-21|1996-04-30|Dynal As|Oligonucleotide-linked magnetic particles and uses thereof|

---

US5595726A|1992-01-21|1997-01-21|Pharmacyclics, Inc.|Chromophore probe for detection of nucleic acid|

---

US5599923A|1989-03-06|1997-02-04|Board Of Regents, University Of Tx|Texaphyrin metal complexes having improved functionalization|

---

US5457183A|1989-03-06|1995-10-10|Board Of Regents, The University Of Texas System|Hydroxylated texaphyrins|

---

US5565552A|1992-01-21|1996-10-15|Pharmacyclics, Inc.|Method of expanded porphyrin-oligonucleotide conjugate synthesis|

---

US5354844A|1989-03-16|1994-10-11|Boehringer Ingelheim International Gmbh|Protein-polycation conjugates|

---

US5108921A|1989-04-03|1992-04-28|Purdue Research Foundation|Method for enhanced transmembrane transport of exogenous molecules|

---

US5391723A|1989-05-31|1995-02-21|Neorx Corporation|Oligonucleotide conjugates|

---

US5256775A|1989-06-05|1993-10-26|Gilead Sciences, Inc.|Exonuclease-resistant oligonucleotides|

---

US4958013A|1989-06-06|1990-09-18|Northwestern University|Cholesteryl modified oligonucleotides|

---

US6582908B2|1990-12-06|2003-06-24|Affymetrix, Inc.|Oligonucleotides|

---

US5227170A|1989-06-22|1993-07-13|Vestar, Inc.|Encapsulation process|

---

US5451463A|1989-08-28|1995-09-19|Clontech Laboratories, Inc.|Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides|

---

US5134066A|1989-08-29|1992-07-28|Monsanto Company|Improved probes using nucleosides containing 3-dezauracil analogs|

---

US5254469A|1989-09-12|1993-10-19|Eastman Kodak Company|Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures|

---

US5591722A|1989-09-15|1997-01-07|Southern Research Institute|2'-deoxy-4'-thioribonucleosides and their antiviral activity|

---

US5356633A|1989-10-20|1994-10-18|Liposome Technology, Inc.|Method of treatment of inflamed tissues|

---

US5013556A|1989-10-20|1991-05-07|Liposome Technology, Inc.|Liposomes with enhanced circulation time|

---

US5527528A|1989-10-20|1996-06-18|Sequus Pharmaceuticals, Inc.|Solid-tumor treatment method|

---

US5721218A|1989-10-23|1998-02-24|Gilead Sciences, Inc.|Oligonucleotides with inverted polarity|

---

US5399676A|1989-10-23|1995-03-21|Gilead Sciences|Oligonucleotides with inverted polarity|

---

US5264564A|1989-10-24|1993-11-23|Gilead Sciences|Oligonucleotide analogs with novel linkages|

---

AT190981T|1989-10-24|2000-04-15|Isis Pharmaceuticals Inc|2'-MODIFIED NUCLEOTIDES|

---

US5264562A|1989-10-24|1993-11-23|Gilead Sciences, Inc.|Oligonucleotide analogs with novel linkages|

---

US5292873A|1989-11-29|1994-03-08|The Research Foundation Of State University Of New York|Nucleic acids labeled with naphthoquinone probe|

---

US5177198A|1989-11-30|1993-01-05|University Of N.C. At Chapel Hill|Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates|

---

US5130302A|1989-12-20|1992-07-14|Boron Bilogicals, Inc.|Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same|

---

US5469854A|1989-12-22|1995-11-28|Imarx Pharmaceutical Corp.|Methods of preparing gas-filled liposomes|

---

US5580575A|1989-12-22|1996-12-03|Imarx Pharmaceutical Corp.|Therapeutic drug delivery systems|

---

US5486603A|1990-01-08|1996-01-23|Gilead Sciences, Inc.|Oligonucleotide having enhanced binding affinity|

---

US5587470A|1990-01-11|1996-12-24|Isis Pharmaceuticals, Inc.|3-deazapurines|

---

US5681941A|1990-01-11|1997-10-28|Isis Pharmaceuticals, Inc.|Substituted purines and oligonucleotide cross-linking|

---

US5646265A|1990-01-11|1997-07-08|Isis Pharmceuticals, Inc.|Process for the preparation of 2'-O-alkyl purine phosphoramidites|

---

US5459255A|1990-01-11|1995-10-17|Isis Pharmaceuticals, Inc.|N-2 substituted purines|

---

US5578718A|1990-01-11|1996-11-26|Isis Pharmaceuticals, Inc.|Thiol-derivatized nucleosides|

---

US5670633A|1990-01-11|1997-09-23|Isis Pharmaceuticals, Inc.|Sugar modified oligonucleotides that detect and modulate gene expression|

---

US5587361A|1991-10-15|1996-12-24|Isis Pharmaceuticals, Inc.|Oligonucleotides having phosphorothioate linkages of high chiral purity|

---

US5220007A|1990-02-15|1993-06-15|The Worcester Foundation For Experimental Biology|Method of site-specific alteration of RNA and production of encoded polypeptides|

---

US5149797A|1990-02-15|1992-09-22|The Worcester Foundation For Experimental Biology|Method of site-specific alteration of rna and production of encoded polypeptides|

---

US5214136A|1990-02-20|1993-05-25|Gilead Sciences, Inc.|Anthraquinone-derivatives oligonucleotides|

---

WO1991013080A1|1990-02-20|1991-09-05|Gilead Sciences, Inc.|Pseudonucleosides and pseudonucleotides and their polymers|

---

US5321131A|1990-03-08|1994-06-14|Hybridon, Inc.|Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling|

---

US5470967A|1990-04-10|1995-11-28|The Dupont Merck Pharmaceutical Company|Oligonucleotide analogs with sulfamate linkages|

---

US5264618A|1990-04-19|1993-11-23|Vical, Inc.|Cationic lipids for intracellular delivery of biologically active molecules|

---

GB9009980D0|1990-05-03|1990-06-27|Amersham Int Plc|Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides|

---

DE69032425T2|1990-05-11|1998-11-26|Microprobe Corp|Immersion test strips for nucleic acid hybridization assays and methods for covalently immobilizing oligonucleotides|

---

US5541307A|1990-07-27|1996-07-30|Isis Pharmaceuticals, Inc.|Backbone modified oligonucleotide analogs and solid phase synthesis thereof|

---

US5608046A|1990-07-27|1997-03-04|Isis Pharmaceuticals, Inc.|Conjugated 4'-desmethyl nucleoside analog compounds|

---

US5489677A|1990-07-27|1996-02-06|Isis Pharmaceuticals, Inc.|Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms|

---

US5618704A|1990-07-27|1997-04-08|Isis Pharmacueticals, Inc.|Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling|

---

US5602240A|1990-07-27|1997-02-11|Ciba Geigy Ag.|Backbone modified oligonucleotide analogs|

---

US5623070A|1990-07-27|1997-04-22|Isis Pharmaceuticals, Inc.|Heteroatomic oligonucleoside linkages|

---

US5677437A|1990-07-27|1997-10-14|Isis Pharmaceuticals, Inc.|Heteroatomic oligonucleoside linkages|

---

US5378825A|1990-07-27|1995-01-03|Isis Pharmaceuticals, Inc.|Backbone modified oligonucleotide analogs|

---

US5614617A|1990-07-27|1997-03-25|Isis Pharmaceuticals, Inc.|Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression|

---

US5688941A|1990-07-27|1997-11-18|Isis Pharmaceuticals, Inc.|Methods of making conjugated 4' desmethyl nucleoside analog compounds|

---

US5610289A|1990-07-27|1997-03-11|Isis Pharmaceuticals, Inc.|Backbone modified oligonucleotide analogues|

---

US5218105A|1990-07-27|1993-06-08|Isis Pharmaceuticals|Polyamine conjugated oligonucleotides|

---

US5138045A|1990-07-27|1992-08-11|Isis Pharmaceuticals|Polyamine conjugated oligonucleotides|

---

US5386023A|1990-07-27|1995-01-31|Isis Pharmaceuticals|Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling|

---

US5245022A|1990-08-03|1993-09-14|Sterling Drug, Inc.|Exonuclease resistant terminally substituted oligonucleotides|

---

EP0541722B1|1990-08-03|1995-12-20|Sterling Winthrop Inc.|Compounds and methods for inhibiting gene expression|

---

US5223618A|1990-08-13|1993-06-29|Isis Pharmaceuticals, Inc.|4'-desmethyl nucleoside analog compounds|

---

US5623065A|1990-08-13|1997-04-22|Isis Pharmaceuticals, Inc.|Gapped 2' modified oligonucleotides|

---

US5177196A|1990-08-16|1993-01-05|Microprobe Corporation|Oligo and α-arabinofuranosyl precursors thereof|

---

US5512667A|1990-08-28|1996-04-30|Reed; Michael W.|Trifunctional intermediates for preparing 3'-tailed oligonucleotides|

---

US5214134A|1990-09-12|1993-05-25|Sterling Winthrop Inc.|Process of linking nucleosides with a siloxane bridge|

---

US5561225A|1990-09-19|1996-10-01|Southern Research Institute|Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages|

---

US5596086A|1990-09-20|1997-01-21|Gilead Sciences, Inc.|Modified internucleoside linkages having one nitrogen and two carbon atoms|

---

US5432272A|1990-10-09|1995-07-11|Benner; Steven A.|Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases|

---

EP0556301B1|1990-11-08|2001-01-10|Hybridon, Inc.|Incorporation of multiple reporter groups on synthetic oligonucleotides|

---

US5672697A|1991-02-08|1997-09-30|Gilead Sciences, Inc.|Nucleoside 5'-methylene phosphonates|

---

JP3220180B2|1991-05-23|2001-10-22|三菱化学株式会社|Drug-containing protein-bound liposomes|

---

US5714331A|1991-05-24|1998-02-03|Buchardt, Deceased; Ole|Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility|

---

US5719262A|1993-11-22|1998-02-17|Buchardt, Deceased; Ole|Peptide nucleic acids having amino acid side chains|

---

US5371241A|1991-07-19|1994-12-06|Pharmacia P-L Biochemicals Inc.|Fluorescein labelled phosphoramidites|

---

US5571799A|1991-08-12|1996-11-05|Basco, Ltd.| oligoadenylate analogues useful as inhibitors of host-v5.-graft response|

---

US5521291A|1991-09-30|1996-05-28|Boehringer Ingelheim International, Gmbh|Conjugates for introducing nucleic acid into higher eucaryotic cells|

---

NZ244306A|1991-09-30|1995-07-26|Boehringer Ingelheim Int|Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation|

---

ES2103918T3|1991-10-17|1997-10-01|Ciba Geigy Ag|BICYCLE NUCLEOSIDES, OLIGONUCLEOTIDES, PROCEDURE FOR THEIR OBTAINING AND INTERMEDIATE PRODUCTS.|

---

DE69233046T2|1991-10-24|2004-03-04|Isis Pharmaceuticals, Inc., Carlsfeld|DERIVATIZED OLIGONUCLEOTIDS WITH IMPROVED CAPACITY|

---

US5594121A|1991-11-07|1997-01-14|Gilead Sciences, Inc.|Enhanced triple-helix and double-helix formation with oligomers containing modified purines|

---

JP3739785B2|1991-11-26|2006-01-25|アイシスファーマシューティカルズ，インコーポレイティド|Enhanced triple and double helix shaping using oligomers containing modified pyrimidines|

---

TW393513B|1991-11-26|2000-06-11|Isis Pharmaceuticals Inc|Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines|

---

US5484908A|1991-11-26|1996-01-16|Gilead Sciences, Inc.|Oligonucleotides containing 5-propynyl pyrimidines|

---

US5792608A|1991-12-12|1998-08-11|Gilead Sciences, Inc.|Nuclease stable and binding competent oligomers and methods for their use|

---

US5359044A|1991-12-13|1994-10-25|Isis Pharmaceuticals|Cyclobutyl oligonucleotide surrogates|

---

US5700922A|1991-12-24|1997-12-23|Isis Pharmaceuticals, Inc.|PNA-DNA-PNA chimeric macromolecules|

---

FR2687679B1|1992-02-05|1994-10-28|Centre Nat Rech Scient|OLIGOTHIONUCLEOTIDES.|

---

US5633360A|1992-04-14|1997-05-27|Gilead Sciences, Inc.|Oligonucleotide analogs capable of passive cell membrane permeation|

---

US5434257A|1992-06-01|1995-07-18|Gilead Sciences, Inc.|Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages|

---

EP0577558A3|1992-07-01|1994-04-20|Ciba Geigy Ag|

---

US5272250A|1992-07-10|1993-12-21|Spielvogel Bernard F|Boronated phosphoramidate compounds|

---

US5652355A|1992-07-23|1997-07-29|Worcester Foundation For Experimental Biology|Hybrid oligonucleotide phosphorothioates|

---

EP0652890B1|1992-07-27|1998-01-14|HYBRIDON, Inc.|Oligonucleotide alkylphosphonothioates|

---

US5583020A|1992-11-24|1996-12-10|Ribozyme Pharmaceuticals, Inc.|Permeability enhancers for negatively charged polynucleotides|

---

RU95114435A|1992-12-14|1997-05-20|Ханивелл Инк. |System incorporating brushless dc motor|

---

US5574142A|1992-12-15|1996-11-12|Microprobe Corporation|Peptide linkers for improved oligonucleotide delivery|

---

JP3351476B2|1993-01-22|2002-11-25|三菱化学株式会社|Phospholipid derivatives and liposomes containing the same|

---

ES2086997T3|1993-01-25|1996-07-01|Hybridon Inc|OLIGONUCLEOTIDE-ALKYLPHOSPHONATES AND -ALKYLPHOSPHONOTIOATES.|

---

US5476925A|1993-02-01|1995-12-19|Northwestern University|Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups|

---

US5395619A|1993-03-03|1995-03-07|Liposome Technology, Inc.|Lipid-polymer conjugates and liposomes|

---

GB9304620D0|1993-03-06|1993-04-21|Ciba Geigy Ag|Compounds|

---

GB9304618D0|1993-03-06|1993-04-21|Ciba Geigy Ag|Chemical compounds|

---

AT155467T|1993-03-30|1997-08-15|Sanofi Sa|ACYCLIC NUCLEOSIDE ANALOGS AND THEIR OLIGONUCLEOTIDE SEQUENCES|

---

DE69407032T2|1993-03-31|1998-07-02|Sanofi Sa|OLIGONUCLEOTIDES WITH AMIDE CHAINS USE THE PHOSPHOESTER CHAINS|

---

DE4311944A1|1993-04-10|1994-10-13|Degussa|Coated sodium percarbonate particles, process for their preparation and detergent, cleaning and bleaching compositions containing them|

---

US5462854A|1993-04-19|1995-10-31|Beckman Instruments, Inc.|Inverse linkage oligonucleotides for chemical and enzymatic processes|

---

US5539082A|1993-04-26|1996-07-23|Nielsen; Peter E.|Peptide nucleic acids|

---

US5534259A|1993-07-08|1996-07-09|Liposome Technology, Inc.|Polymer compound and coated particle composition|

---

US5543158A|1993-07-23|1996-08-06|Massachusetts Institute Of Technology|Biodegradable injectable nanoparticles|

---

US5417978A|1993-07-29|1995-05-23|Board Of Regents, The University Of Texas System|Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use|

---

US5502177A|1993-09-17|1996-03-26|Gilead Sciences, Inc.|Pyrimidine derivatives for labeled binding partners|

---

US5801154A|1993-10-18|1998-09-01|Isis Pharmaceuticals, Inc.|Antisense oligonucleotide modulation of multidrug resistance-associated protein|

---

US5744368A|1993-11-04|1998-04-28|Research Foundation Of State University Of New York|Methods for the detection of soluble amyloid β-protein or soluble transthyretin |

---

US5457187A|1993-12-08|1995-10-10|Board Of Regents University Of Nebraska|Oligonucleotides containing 5-fluorouracil|

---

US5446137B1|1993-12-09|1998-10-06|Behringwerke Ag|Oligonucleotides containing 4'-substituted nucleotides|

---

CN1048254C|1993-12-09|2000-01-12|托马斯杰弗逊大学|Compounds and methods for site-directed mutations in eukaryotic cells|

---

US5595756A|1993-12-22|1997-01-21|Inex Pharmaceuticals Corporation|Liposomal compositions for enhanced retention of bioactive agents|

---

US5519134A|1994-01-11|1996-05-21|Isis Pharmaceuticals, Inc.|Pyrrolidine-containing monomers and oligomers|

---

US5596091A|1994-03-18|1997-01-21|The Regents Of The University Of California|Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides|

---

US5627053A|1994-03-29|1997-05-06|Ribozyme Pharmaceuticals, Inc.|2'deoxy-2'-alkylnucleotide containing nucleic acid|

---

US5625050A|1994-03-31|1997-04-29|Amgen Inc.|Modified oligonucleotides and intermediates useful in nucleic acid therapeutics|

---

US5646269A|1994-04-28|1997-07-08|Gilead Sciences, Inc.|Method for oligonucleotide analog synthesis|

---

US5525711A|1994-05-18|1996-06-11|The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services|Pteridine nucleotide analogs as fluorescent DNA probes|

---

US5543152A|1994-06-20|1996-08-06|Inex Pharmaceuticals Corporation|Sphingosomes for enhanced drug delivery|

---

US5597696A|1994-07-18|1997-01-28|Becton Dickinson And Company|Covalent cyanine dye oligonucleotide conjugates|

---

US5597909A|1994-08-25|1997-01-28|Chiron Corporation|Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use|

---

US5580731A|1994-08-25|1996-12-03|Chiron Corporation|N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith|

---

US5591721A|1994-10-25|1997-01-07|Hybridon, Inc.|Method of down-regulating gene expression|

---

US5512295A|1994-11-10|1996-04-30|The Board Of Trustees Of The Leland Stanford Junior University|Synthetic liposomes for enhanced uptake and delivery|

---

US5792747A|1995-01-24|1998-08-11|The Administrators Of The Tulane Educational Fund|Highly potent agonists of growth hormone releasing hormone|

---

US5652356A|1995-08-17|1997-07-29|Hybridon, Inc.|Inverted chimeric and hybrid oligonucleotides|

---

US5656408A|1996-04-29|1997-08-12|Xerox Corporation|Coated carrier particles|

---

US6143037A|1996-06-12|2000-11-07|The Regents Of The University Of Michigan|Compositions and methods for coating medical devices|

---

US6248720B1|1996-07-03|2001-06-19|Brown University Research Foundation|Method for gene therapy using nucleic acid loaded polymeric microparticles|

---

US6770748B2|1997-03-07|2004-08-03|Takeshi Imanishi|Bicyclonucleoside and oligonucleotide analogue|

---

JP3756313B2|1997-03-07|2006-03-15|武 今西|Novel bicyclonucleosides and oligonucleotide analogues|

---

AT321882T|1997-07-01|2006-04-15|Isis Pharmaceuticals Inc|COMPOSITIONS AND METHOD FOR THE ADMINISTRATION OF OLIGONUCLEOTIDES OVER THE DISHES|

---

CA2303299C|1997-09-12|2016-02-23|Exiqon A/S|Oligonucleotide analogues|

---

US6794499B2|1997-09-12|2004-09-21|Exiqon A/S|Oligonucleotide analogues|

---

US20030203862A1|1998-03-26|2003-10-30|Miraglia Loren J.|Antisense modulation of MDM2 expression|

---

US20030228597A1|1998-04-13|2003-12-11|Cowsert Lex M.|Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation|

---

US5951455A|1998-12-04|1999-09-14|Isis Pharmaceuticals, Inc.|Antisense modulation of G-alpha-11 expression|

---

US20040226056A1|1998-12-22|2004-11-11|Myriad Genetics, Incorporated|Compositions and methods for treating neurological disorders and diseases|

---

AU3243300A|1999-02-23|2000-09-14|Isis Pharmaceuticals, Inc.|Multiparticulate formulation|

---

US6369209B1|1999-05-03|2002-04-09|Isis Pharmaceuticals, Inc.|Oligonucleotides having A-DNA form and B-DNA form conformational geometry|

---

DE60033927T2|1999-05-04|2007-11-29|Santaris Pharma A/S|L-RIBO-LNA ANALOGUE|

---

US6525191B1|1999-05-11|2003-02-25|Kanda S. Ramasamy|Conformationally constrained L-nucleosides|

---

US6656730B1|1999-06-15|2003-12-02|Isis Pharmaceuticals, Inc.|Oligonucleotides conjugated to protein-binding drugs|

---

US6040179A|1999-06-25|2000-03-21|Isis Pharmaceuticals Inc.|Antisense inhibition of G-alpha-i2 expression|

---

US20040002153A1|1999-07-21|2004-01-01|Monia Brett P.|Modulation of PTEN expression via oligomeric compounds|

---

US6284538B1|1999-07-21|2001-09-04|Isis Pharmaceuticals, Inc.|Antisense inhibition of PTEN expression|

---

US6165728A|1999-11-19|2000-12-26|Isis Pharmaceuticals Inc.|Antisense modulation of NCK-2 expression|

---

US6287860B1|2000-01-20|2001-09-11|Isis Pharmaceuticals, Inc.|Antisense inhibition of MEKK2 expression|

---

EP1386004A4|2001-04-05|2005-02-16|Ribozyme Pharm Inc|Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies|

---

US6974667B2|2000-06-14|2005-12-13|Gene Logic, Inc.|Gene expression profiles in liver cancer|

---

US6383809B1|2000-10-30|2002-05-07|Isis Pharmaceuticals, Inc.|Antisense inhibition of cytohesin-1 expression|

---

US6426220B1|2000-10-30|2002-07-30|Isis Pharmaceuticals, Inc.|Antisense modulation of calreticulin expression|

---

WO2002059621A2|2001-01-24|2002-08-01|Bayer Corporation|Regulation of transthyretin to treat obesity|

---

US6468796B1|2001-04-27|2002-10-22|Isis Pharmaceuticals, Inc.|Antisense modulation of bifunctional apoptosis regulator expression|

---

US20040138163A1|2002-05-29|2004-07-15|Mcswiggen James|RNA interference mediated inhibition of vascular edothelial growth factor and vascular edothelial growth factor receptor gene expression using short interfering nucleic acid |

---

WO2003004602A2|2001-07-03|2003-01-16|Isis Pharmaceuticals, Inc.|Nuclease resistant chimeric oligonucleotides|

---

AU2003213119A1|2002-02-20|2003-09-09|Sirna Therapeutics, Inc.|RNA INTERFERENCE MEDIATED INHIBITION OF BCL2 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID |

---

US7399586B2|2002-05-23|2008-07-15|Ceptyr, Inc.|Modulation of biological signal transduction by RNA interference|

---

US7148342B2|2002-07-24|2006-12-12|The Trustees Of The University Of Pennyslvania|Compositions and methods for sirna inhibition of angiogenesis|

---

US20050058982A1|2002-07-26|2005-03-17|Chiron Corporation|Modified small interfering RNA molecules and methods of use|

---

AU2003258183B2|2002-08-16|2009-03-26|Rexahn Pharmaceuticals, Inc.|Use of antisense oligonucleotides to inhibit the expression of Akt-1|

---

EP1560840B1|2002-11-05|2015-05-06|Isis Pharmaceuticals, Inc.|Compositions comprising alternating 2'-modified nucleosides for use in gene modulation|

---

WO2004041889A2|2002-11-05|2004-05-21|Isis Pharmaceuticals, Inc.|Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation|

---

US7250496B2|2002-11-14|2007-07-31|Rosetta Genomics Ltd.|Bioinformatically detectable group of novel regulatory genes and uses thereof|

---

US7888497B2|2003-08-13|2011-02-15|Rosetta Genomics Ltd.|Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof|

---

JP2006507841A|2002-11-14|2006-03-09|ダーマコン，インコーポレイテッド|Functional and ultrafunctional siRNA|

---

US7655785B1|2002-11-14|2010-02-02|Rosetta Genomics Ltd.|Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof|

---

US20130130231A1|2002-11-26|2013-05-23|Isaac Bentwich|Bioinformatically detectable group of novel viral regulatory genes and uses thereof|

---

US7696334B1|2002-12-05|2010-04-13|Rosetta Genomics, Ltd.|Bioinformatically detectable human herpesvirus 5 regulatory gene|

---

DE602004022921D1|2003-01-31|2009-10-15|Rexahn Corp|ANTISENSE OLIGONUCLEOTIDES WHICH HARM THE STUDY OF HIF-1|

---

WO2005049806A2|2003-03-14|2005-06-02|Nuvelo, Inc.|Novel nucleic acids and polypeptides|

---

WO2004106356A1|2003-05-27|2004-12-09|Syddansk Universitet|Functionalized nucleotide derivatives|

---

US7244764B2|2003-06-23|2007-07-17|Neurochem Limited|Methods and compositions for treating amyloid-related diseases|

---

EP1661905B9|2003-08-28|2012-12-19|IMANISHI, Takeshi|Novel artificial nucleic acids of n-o bond crosslinkage type|

---

JP5379347B2|2003-09-18|2013-12-25|アイシスファーマシューティカルズ，インコーポレーテッド|4'-thionucleosides and oligomeric compounds|

---

US20050244869A1|2004-04-05|2005-11-03|Brown-Driver Vickie L|Modulation of transthyretin expression|

---

AU2005244999A1|2004-05-20|2005-12-01|The Scripps Research Institute|Transthyretin stabilization|

---

EP2397563A3|2004-09-17|2012-07-18|Isis Pharmaceuticals, Inc.|Enhanced antisense oligonucleotides|

---

WO2006048291A2|2004-11-03|2006-05-11|Almac Diagnostics Limited|Transcriptome microarray technology and methods of using the same|

---

ES2453380T3|2006-01-26|2014-04-07|Isis Pharmaceuticals, Inc.|Compositions and uses directed towards huntingtin|

---

KR20130042043A|2006-01-27|2013-04-25|아이시스 파마수티컬즈 인코포레이티드|6-modified bicyclic nucleic acid analogs|

---

WO2007134181A2|2006-05-11|2007-11-22|Isis Pharmaceuticals, Inc.|5'-modified bicyclic nucleic acid analogs|

---

US20100190837A1|2007-02-15|2010-07-29|Isis Pharmaceuticals, Inc.|5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom|

---

ES2388590T3|2007-05-30|2012-10-16|Isis Pharmaceuticals, Inc.|Analogs of bicyclic nucleic acids with N-substituted aminomethylene bridge.|

---

US8278426B2|2007-06-08|2012-10-02|Isis Pharmaceuticals, Inc.|Carbocyclic bicyclic nucleic acid analogs|

---

CN101796062B|2007-07-05|2014-07-30|Isis制药公司|6-disubstituted bicyclic nucleic acid analogs|

---

ES2439591T3|2007-08-15|2014-01-23|Isis Pharmaceuticals, Inc.|Tetrahydropyran nucleic acid analogs|

---

EP3693470A1|2007-12-28|2020-08-12|Prothena Therapeutics Limited|Treatment and prophylaxis of amyloidosis|

---

WO2009143390A2|2008-05-22|2009-11-26|Isis Pharmaceuticals, Inc.|Methods for modulating expression of rbp4|

---

PT2307381T|2008-06-09|2021-03-15|Univ Muenchen Ludwig Maximilians|New drugs for inhibiting aggregation of proteins involved in diseases linked to protein aggregation and/or neurodegenerative diseases|

---

WO2010017509A1|2008-08-07|2010-02-11|Isis Pharmaceuticals, Inc.|Modulation of transthyretin expression for the treatment of cns related disorders|

---

NZ592867A|2008-10-20|2013-05-31|Alnylam Pharmaceuticals Inc|Compositions and methods for inhibiting expression of transthyretin|

---

AT507215B1|2009-01-14|2010-03-15|Boehler Edelstahl Gmbh & Co Kg|WEAR-RESISTANT MATERIAL|

---

LT2563920T|2010-04-29|2017-05-25|Ionis Pharmaceuticals, Inc.|Modulation of transthyretin expression|

---

RS60414B1|2011-11-18|2020-07-31|Alnylam Pharmaceuticals Inc|Rnai agents, compositions and methods of use thereof for treating transthyretin associated diseases|

---

US9984408B1|2012-05-30|2018-05-29|Amazon Technologies, Inc.|Method, medium, and system for live video cooperative shopping|

---

US9778708B1|2016-07-18|2017-10-03|Lenovo Enterprise Solutions Pte. Ltd.|Dual sided latching retainer for computer modules|US9228186B2|2002-11-14|2016-01-05|Thermo Fisher Scientific Inc.|Methods and compositions for selecting siRNA of improved functionality|

---

NZ592867A|2008-10-20|2013-05-31|Alnylam Pharmaceuticals Inc|Compositions and methods for inhibiting expression of transthyretin|

---

WO2011056883A1|2009-11-03|2011-05-12|Alnylam Pharmaceuticals, Inc.|Lipid formulated compositions and methods for inhibiting expression of transthyretin |

---

LT2563920T|2010-04-29|2017-05-25|Ionis Pharmaceuticals, Inc.|Modulation of transthyretin expression|

---

US9580708B2|2011-09-14|2017-02-28|Rana Therapeutics, Inc.|Multimeric oligonucleotides compounds|

---

RS60414B1|2011-11-18|2020-07-31|Alnylam Pharmaceuticals Inc|Rnai agents, compositions and methods of use thereof for treating transthyretinassociated diseases|

---

AU2013262709A1|2012-05-16|2015-01-22|Rana Therapeutics, Inc.|Compositions and methods for modulating MECP2 expression|

---

US10837014B2|2012-05-16|2020-11-17|Translate Bio Ma, Inc.|Compositions and methods for modulating SMN gene family expression|

---

US20160002624A1|2012-05-17|2016-01-07|Isis Pharmaceuticals, Inc.|Antisense oligonucleotide compositions|

---

US9574193B2|2012-05-17|2017-02-21|Ionis Pharmaceuticals, Inc.|Methods and compositions for modulating apolipoproteinexpression|

---

JP2015529469A|2012-09-14|2015-10-08|ラナ セラピューティクス インコーポレイテッド|Multimeric oligonucleotide compounds|

---

CN104884618A|2012-11-15|2015-09-02|罗氏创新中心哥本哈根有限公司|Oligonucleotide conjugates|

---

WO2014118267A1|2013-01-30|2014-08-07|Santaris Pharma A/S|Lna oligonucleotide carbohydrate conjugates|

---

RS58981B1|2013-05-01|2019-08-30|Ionis Pharmaceuticals Inc|Compositions and methods for modulating hbv and ttr expression|

---

PT3137596T|2014-05-01|2019-09-27|Ionis Pharmaceuticals Inc|Compositions and methods for modulating complement factor b expression|

---

US10570169B2|2014-05-22|2020-02-25|Ionis Pharmaceuticals, Inc.|Conjugated antisense compounds and their use|

---

KR20170046755A|2014-08-29|2017-05-02|알닐람 파마슈티칼스 인코포레이티드|Methods of treating transthyretin mediated amyloidosis|

---

EP3256591A4|2015-02-13|2018-08-08|Translate Bio Ma, Inc.|Hybrid oligonucleotides and uses thereof|

---

EP3256592A4|2015-02-13|2018-09-12|Translate Bio Ma, Inc.|Compositions and methods for modulating rna|

---

US10851371B2|2015-04-10|2020-12-01|Ionis Pharmaceuticals, Inc.|Modulation of SMN expression|

---

MX2018000981A|2015-07-31|2018-06-11|Alnylam Pharmaceuticals Inc|TRANSTHYRETINiRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING OR PREVENTING TTR-ASSOCIATED DISEASES.|

---

WO2017100587A1|2015-12-09|2017-06-15|Alnylam Pharmaceuticals, Inc.|Polynucleotide agents targeting programmed cell death 1 ligand 1and methods of use thereof|

---

EP3471779A4|2016-06-16|2020-07-08|Ionis Pharmaceuticals, Inc.|Combinations for the modulation of smn expression|

---

BR112020005230A2|2017-09-19|2020-09-24|Alnylam Pharmaceuticals, Inc.|compositions and methods for the treatment of transthyretin-mediated amyloidosis |

---

US20220071965A1|2018-12-20|2022-03-10|Pfizer Inc.|Pharmaceutical Compositions and Methods Comprising A Combination of a Benzoxazole Transthyretin Stabilizer and an Additional Therapeutic Agent|

---

WO2021041884A1|2019-08-30|2021-03-04|Alnylam Pharmaceuticals, Inc.|Neurofilament light chainas a biomarker for transthyretin amyloidosis polyneuropathy|

---

WO2021178778A1|2020-03-06|2021-09-10|Alnylam Pharmaceuticals, Inc.|Compositions and methods for inhibiting expression of transthyretin |

---

WO2022040582A1|2020-08-21|2022-02-24|Precision Biosciences, Inc.|Engineered meganucleases having specificity for a recognition sequence in the transthyretin gene|

法律状态:
2020-11-10| B25D| Requested change of name of applicant approved|Owner name: IONIS PHARMACEUTICALS, INC. (US) |

---

2020-11-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-11-24| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-03-23| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2021-07-06| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2021-09-08| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2021-11-23| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US32953810P| true| 2010-04-29|2010-04-29|

---

US61/329,538|2010-04-29|

---

US40516310P| true| 2010-10-20|2010-10-20|

---

US61/405,163|2010-10-20|

---

PCT/US2011/034661|WO2011139917A1|2010-04-29|2011-04-29|Modulation of transthyretin expression|

---